ID: 1022842176

View in Genome Browser
Species Human (GRCh38)
Location 7:34175203-34175225
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4375
Summary {0: 5, 1: 920, 2: 1493, 3: 979, 4: 978}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842171_1022842176 22 Left 1022842171 7:34175158-34175180 CCCAGCCTCGCTGCCGCCTTGCA 0: 1085
1: 2164
2: 1733
3: 667
4: 510
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842174_1022842176 9 Left 1022842174 7:34175171-34175193 CCGCCTTGCAGTGTGATCTCAGA 0: 8
1: 2877
2: 1001
3: 473
4: 522
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842166_1022842176 29 Left 1022842166 7:34175151-34175173 CCCCTCCCCCAGCCTCGCTGCCG 0: 1015
1: 2056
2: 1763
3: 968
4: 1261
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842170_1022842176 23 Left 1022842170 7:34175157-34175179 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842173_1022842176 17 Left 1022842173 7:34175163-34175185 CCTCGCTGCCGCCTTGCAGTGTG 0: 5
1: 1087
2: 2036
3: 1634
4: 944
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842172_1022842176 21 Left 1022842172 7:34175159-34175181 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842169_1022842176 24 Left 1022842169 7:34175156-34175178 CCCCCAGCCTCGCTGCCGCCTTG 0: 1037
1: 2094
2: 1697
3: 760
4: 655
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842168_1022842176 27 Left 1022842168 7:34175153-34175175 CCTCCCCCAGCCTCGCTGCCGCC 0: 985
1: 2028
2: 1771
3: 1042
4: 1585
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842167_1022842176 28 Left 1022842167 7:34175152-34175174 CCCTCCCCCAGCCTCGCTGCCGC 0: 1025
1: 2065
2: 1803
3: 995
4: 1258
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1022842175_1022842176 6 Left 1022842175 7:34175174-34175196 CCTTGCAGTGTGATCTCAGACTG 0: 10
1: 3679
2: 1433
3: 764
4: 724
Right 1022842176 7:34175203-34175225 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842176 Original CRISPR TAGCAATCAGCGAGACACCG TGG Intergenic
Too many off-targets to display for this crispr