ID: 1022842178

View in Genome Browser
Species Human (GRCh38)
Location 7:34175210-34175232
Sequence CAGCGAGACACCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842172_1022842178 28 Left 1022842172 7:34175159-34175181 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data
1022842170_1022842178 30 Left 1022842170 7:34175157-34175179 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data
1022842174_1022842178 16 Left 1022842174 7:34175171-34175193 CCGCCTTGCAGTGTGATCTCAGA 0: 8
1: 2877
2: 1001
3: 473
4: 522
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data
1022842173_1022842178 24 Left 1022842173 7:34175163-34175185 CCTCGCTGCCGCCTTGCAGTGTG 0: 5
1: 1087
2: 2036
3: 1634
4: 944
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data
1022842175_1022842178 13 Left 1022842175 7:34175174-34175196 CCTTGCAGTGTGATCTCAGACTG 0: 10
1: 3679
2: 1433
3: 764
4: 724
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data
1022842171_1022842178 29 Left 1022842171 7:34175158-34175180 CCCAGCCTCGCTGCCGCCTTGCA 0: 1085
1: 2164
2: 1733
3: 667
4: 510
Right 1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842178 Original CRISPR CAGCGAGACACCGTGGGCGT AGG Intergenic
No off target data available for this crispr