ID: 1022842180

View in Genome Browser
Species Human (GRCh38)
Location 7:34175225-34175247
Sequence GGCGTAGGACCCTCTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5260
Summary {0: 522, 1: 1421, 2: 1460, 3: 1026, 4: 831}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022842175_1022842180 28 Left 1022842175 7:34175174-34175196 CCTTGCAGTGTGATCTCAGACTG 0: 10
1: 3679
2: 1433
3: 764
4: 724
Right 1022842180 7:34175225-34175247 GGCGTAGGACCCTCTGAGCCAGG 0: 522
1: 1421
2: 1460
3: 1026
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022842180 Original CRISPR GGCGTAGGACCCTCTGAGCC AGG Intergenic
Too many off-targets to display for this crispr