ID: 1022850735

View in Genome Browser
Species Human (GRCh38)
Location 7:34259104-34259126
Sequence TCAAAGTCATCGTGGCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022850735_1022850744 23 Left 1022850735 7:34259104-34259126 CCAAGAAGCCACGATGACTTTGA No data
Right 1022850744 7:34259150-34259172 GGAGGAGCATGGAGAAGTCTGGG No data
1022850735_1022850741 12 Left 1022850735 7:34259104-34259126 CCAAGAAGCCACGATGACTTTGA No data
Right 1022850741 7:34259139-34259161 GACCACAAAGTGGAGGAGCATGG No data
1022850735_1022850743 22 Left 1022850735 7:34259104-34259126 CCAAGAAGCCACGATGACTTTGA No data
Right 1022850743 7:34259149-34259171 TGGAGGAGCATGGAGAAGTCTGG No data
1022850735_1022850740 5 Left 1022850735 7:34259104-34259126 CCAAGAAGCCACGATGACTTTGA No data
Right 1022850740 7:34259132-34259154 CCAGAATGACCACAAAGTGGAGG No data
1022850735_1022850737 2 Left 1022850735 7:34259104-34259126 CCAAGAAGCCACGATGACTTTGA No data
Right 1022850737 7:34259129-34259151 TACCCAGAATGACCACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022850735 Original CRISPR TCAAAGTCATCGTGGCTTCT TGG (reversed) Intergenic