ID: 1022850736

View in Genome Browser
Species Human (GRCh38)
Location 7:34259112-34259134
Sequence TGGGTAACTCAAAGTCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022850736_1022850737 -6 Left 1022850736 7:34259112-34259134 CCACGATGACTTTGAGTTACCCA No data
Right 1022850737 7:34259129-34259151 TACCCAGAATGACCACAAAGTGG No data
1022850736_1022850744 15 Left 1022850736 7:34259112-34259134 CCACGATGACTTTGAGTTACCCA No data
Right 1022850744 7:34259150-34259172 GGAGGAGCATGGAGAAGTCTGGG No data
1022850736_1022850743 14 Left 1022850736 7:34259112-34259134 CCACGATGACTTTGAGTTACCCA No data
Right 1022850743 7:34259149-34259171 TGGAGGAGCATGGAGAAGTCTGG No data
1022850736_1022850740 -3 Left 1022850736 7:34259112-34259134 CCACGATGACTTTGAGTTACCCA No data
Right 1022850740 7:34259132-34259154 CCAGAATGACCACAAAGTGGAGG No data
1022850736_1022850741 4 Left 1022850736 7:34259112-34259134 CCACGATGACTTTGAGTTACCCA No data
Right 1022850741 7:34259139-34259161 GACCACAAAGTGGAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022850736 Original CRISPR TGGGTAACTCAAAGTCATCG TGG (reversed) Intergenic
No off target data available for this crispr