ID: 1022850738

View in Genome Browser
Species Human (GRCh38)
Location 7:34259131-34259153
Sequence CTCCACTTTGTGGTCATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022850738_1022850745 12 Left 1022850738 7:34259131-34259153 CCCAGAATGACCACAAAGTGGAG No data
Right 1022850745 7:34259166-34259188 GTCTGGGAAGCCACCACTAGTGG No data
1022850738_1022850743 -5 Left 1022850738 7:34259131-34259153 CCCAGAATGACCACAAAGTGGAG No data
Right 1022850743 7:34259149-34259171 TGGAGGAGCATGGAGAAGTCTGG No data
1022850738_1022850744 -4 Left 1022850738 7:34259131-34259153 CCCAGAATGACCACAAAGTGGAG No data
Right 1022850744 7:34259150-34259172 GGAGGAGCATGGAGAAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022850738 Original CRISPR CTCCACTTTGTGGTCATTCT GGG (reversed) Intergenic
No off target data available for this crispr