ID: 1022850740

View in Genome Browser
Species Human (GRCh38)
Location 7:34259132-34259154
Sequence CCAGAATGACCACAAAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022850736_1022850740 -3 Left 1022850736 7:34259112-34259134 CCACGATGACTTTGAGTTACCCA No data
Right 1022850740 7:34259132-34259154 CCAGAATGACCACAAAGTGGAGG No data
1022850735_1022850740 5 Left 1022850735 7:34259104-34259126 CCAAGAAGCCACGATGACTTTGA No data
Right 1022850740 7:34259132-34259154 CCAGAATGACCACAAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022850740 Original CRISPR CCAGAATGACCACAAAGTGG AGG Intergenic
No off target data available for this crispr