ID: 1022850741

View in Genome Browser
Species Human (GRCh38)
Location 7:34259139-34259161
Sequence GACCACAAAGTGGAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022850735_1022850741 12 Left 1022850735 7:34259104-34259126 CCAAGAAGCCACGATGACTTTGA No data
Right 1022850741 7:34259139-34259161 GACCACAAAGTGGAGGAGCATGG No data
1022850736_1022850741 4 Left 1022850736 7:34259112-34259134 CCACGATGACTTTGAGTTACCCA No data
Right 1022850741 7:34259139-34259161 GACCACAAAGTGGAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022850741 Original CRISPR GACCACAAAGTGGAGGAGCA TGG Intergenic
No off target data available for this crispr