ID: 1022850742

View in Genome Browser
Species Human (GRCh38)
Location 7:34259141-34259163
Sequence CTCCATGCTCCTCCACTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022850742_1022850748 27 Left 1022850742 7:34259141-34259163 CCACAAAGTGGAGGAGCATGGAG No data
Right 1022850748 7:34259191-34259213 GTTTTTTACTTCCAATAATATGG No data
1022850742_1022850745 2 Left 1022850742 7:34259141-34259163 CCACAAAGTGGAGGAGCATGGAG No data
Right 1022850745 7:34259166-34259188 GTCTGGGAAGCCACCACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022850742 Original CRISPR CTCCATGCTCCTCCACTTTG TGG (reversed) Intergenic
No off target data available for this crispr