ID: 1022850744

View in Genome Browser
Species Human (GRCh38)
Location 7:34259150-34259172
Sequence GGAGGAGCATGGAGAAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022850735_1022850744 23 Left 1022850735 7:34259104-34259126 CCAAGAAGCCACGATGACTTTGA No data
Right 1022850744 7:34259150-34259172 GGAGGAGCATGGAGAAGTCTGGG No data
1022850736_1022850744 15 Left 1022850736 7:34259112-34259134 CCACGATGACTTTGAGTTACCCA No data
Right 1022850744 7:34259150-34259172 GGAGGAGCATGGAGAAGTCTGGG No data
1022850739_1022850744 -5 Left 1022850739 7:34259132-34259154 CCAGAATGACCACAAAGTGGAGG No data
Right 1022850744 7:34259150-34259172 GGAGGAGCATGGAGAAGTCTGGG No data
1022850738_1022850744 -4 Left 1022850738 7:34259131-34259153 CCCAGAATGACCACAAAGTGGAG No data
Right 1022850744 7:34259150-34259172 GGAGGAGCATGGAGAAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022850744 Original CRISPR GGAGGAGCATGGAGAAGTCT GGG Intergenic
No off target data available for this crispr