ID: 1022850745

View in Genome Browser
Species Human (GRCh38)
Location 7:34259166-34259188
Sequence GTCTGGGAAGCCACCACTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022850739_1022850745 11 Left 1022850739 7:34259132-34259154 CCAGAATGACCACAAAGTGGAGG No data
Right 1022850745 7:34259166-34259188 GTCTGGGAAGCCACCACTAGTGG No data
1022850742_1022850745 2 Left 1022850742 7:34259141-34259163 CCACAAAGTGGAGGAGCATGGAG No data
Right 1022850745 7:34259166-34259188 GTCTGGGAAGCCACCACTAGTGG No data
1022850738_1022850745 12 Left 1022850738 7:34259131-34259153 CCCAGAATGACCACAAAGTGGAG No data
Right 1022850745 7:34259166-34259188 GTCTGGGAAGCCACCACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022850745 Original CRISPR GTCTGGGAAGCCACCACTAG TGG Intergenic
No off target data available for this crispr