ID: 1022854003

View in Genome Browser
Species Human (GRCh38)
Location 7:34297807-34297829
Sequence GGTCCTTGGATCCTTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022854003_1022854014 16 Left 1022854003 7:34297807-34297829 CCTCCCAGAAGGATCCAAGGACC No data
Right 1022854014 7:34297846-34297868 AATGGACTTCCAGCACAGATTGG No data
1022854003_1022854011 -2 Left 1022854003 7:34297807-34297829 CCTCCCAGAAGGATCCAAGGACC No data
Right 1022854011 7:34297828-34297850 CCCCTGAGGTTGGTGGACAATGG No data
1022854003_1022854009 -9 Left 1022854003 7:34297807-34297829 CCTCCCAGAAGGATCCAAGGACC No data
Right 1022854009 7:34297821-34297843 CCAAGGACCCCTGAGGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022854003 Original CRISPR GGTCCTTGGATCCTTCTGGG AGG (reversed) Intergenic
No off target data available for this crispr