ID: 1022854009

View in Genome Browser
Species Human (GRCh38)
Location 7:34297821-34297843
Sequence CCAAGGACCCCTGAGGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022854003_1022854009 -9 Left 1022854003 7:34297807-34297829 CCTCCCAGAAGGATCCAAGGACC No data
Right 1022854009 7:34297821-34297843 CCAAGGACCCCTGAGGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022854009 Original CRISPR CCAAGGACCCCTGAGGTTGG TGG Intergenic
No off target data available for this crispr