ID: 1022854009 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:34297821-34297843 |
Sequence | CCAAGGACCCCTGAGGTTGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022854003_1022854009 | -9 | Left | 1022854003 | 7:34297807-34297829 | CCTCCCAGAAGGATCCAAGGACC | No data | ||
Right | 1022854009 | 7:34297821-34297843 | CCAAGGACCCCTGAGGTTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022854009 | Original CRISPR | CCAAGGACCCCTGAGGTTGG TGG | Intergenic | ||