ID: 1022854011

View in Genome Browser
Species Human (GRCh38)
Location 7:34297828-34297850
Sequence CCCCTGAGGTTGGTGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022854003_1022854011 -2 Left 1022854003 7:34297807-34297829 CCTCCCAGAAGGATCCAAGGACC No data
Right 1022854011 7:34297828-34297850 CCCCTGAGGTTGGTGGACAATGG No data
1022854004_1022854011 -5 Left 1022854004 7:34297810-34297832 CCCAGAAGGATCCAAGGACCCCT No data
Right 1022854011 7:34297828-34297850 CCCCTGAGGTTGGTGGACAATGG No data
1022854005_1022854011 -6 Left 1022854005 7:34297811-34297833 CCAGAAGGATCCAAGGACCCCTG No data
Right 1022854011 7:34297828-34297850 CCCCTGAGGTTGGTGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022854011 Original CRISPR CCCCTGAGGTTGGTGGACAA TGG Intergenic