ID: 1022860035

View in Genome Browser
Species Human (GRCh38)
Location 7:34358133-34358155
Sequence AGCTATTGCAGTCGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022860035_1022860043 8 Left 1022860035 7:34358133-34358155 CCATGCCCACGACTGCAATAGCT No data
Right 1022860043 7:34358164-34358186 TGCCACAGTGGAGGAGGTACGGG No data
1022860035_1022860046 28 Left 1022860035 7:34358133-34358155 CCATGCCCACGACTGCAATAGCT No data
Right 1022860046 7:34358184-34358206 GGGGAGAGTGAAGAACTGCCTGG No data
1022860035_1022860041 2 Left 1022860035 7:34358133-34358155 CCATGCCCACGACTGCAATAGCT No data
Right 1022860041 7:34358158-34358180 GAGAAATGCCACAGTGGAGGAGG No data
1022860035_1022860040 -1 Left 1022860035 7:34358133-34358155 CCATGCCCACGACTGCAATAGCT No data
Right 1022860040 7:34358155-34358177 TTGGAGAAATGCCACAGTGGAGG No data
1022860035_1022860039 -4 Left 1022860035 7:34358133-34358155 CCATGCCCACGACTGCAATAGCT No data
Right 1022860039 7:34358152-34358174 AGCTTGGAGAAATGCCACAGTGG No data
1022860035_1022860042 7 Left 1022860035 7:34358133-34358155 CCATGCCCACGACTGCAATAGCT No data
Right 1022860042 7:34358163-34358185 ATGCCACAGTGGAGGAGGTACGG No data
1022860035_1022860044 9 Left 1022860035 7:34358133-34358155 CCATGCCCACGACTGCAATAGCT No data
Right 1022860044 7:34358165-34358187 GCCACAGTGGAGGAGGTACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022860035 Original CRISPR AGCTATTGCAGTCGTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr