ID: 1022862282

View in Genome Browser
Species Human (GRCh38)
Location 7:34379969-34379991
Sequence GGCCATTTGAACATTTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022862282_1022862287 23 Left 1022862282 7:34379969-34379991 CCTCTAGAAATGTTCAAATGGCC No data
Right 1022862287 7:34380015-34380037 AAAATTTTTATTGTCTTCCTAGG No data
1022862282_1022862288 30 Left 1022862282 7:34379969-34379991 CCTCTAGAAATGTTCAAATGGCC No data
Right 1022862288 7:34380022-34380044 TTATTGTCTTCCTAGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022862282 Original CRISPR GGCCATTTGAACATTTCTAG AGG (reversed) Intergenic
No off target data available for this crispr