ID: 1022862761

View in Genome Browser
Species Human (GRCh38)
Location 7:34384964-34384986
Sequence TACACTTATATCTATACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022862761_1022862762 24 Left 1022862761 7:34384964-34384986 CCTACTGTATAGATATAAGTGTA No data
Right 1022862762 7:34385011-34385033 TAGCCAGCTAAATACCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022862761 Original CRISPR TACACTTATATCTATACAGT AGG (reversed) Intergenic
No off target data available for this crispr