ID: 1022863872

View in Genome Browser
Species Human (GRCh38)
Location 7:34397169-34397191
Sequence CTCATGAGGTCCCATAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022863866_1022863872 3 Left 1022863866 7:34397143-34397165 CCCTAGTGATATCTCAACTACCA No data
Right 1022863872 7:34397169-34397191 CTCATGAGGTCCCATAAAGGAGG No data
1022863865_1022863872 26 Left 1022863865 7:34397120-34397142 CCGTTGTCTCTCGACTACTTTAG No data
Right 1022863872 7:34397169-34397191 CTCATGAGGTCCCATAAAGGAGG No data
1022863867_1022863872 2 Left 1022863867 7:34397144-34397166 CCTAGTGATATCTCAACTACCAA No data
Right 1022863872 7:34397169-34397191 CTCATGAGGTCCCATAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022863872 Original CRISPR CTCATGAGGTCCCATAAAGG AGG Intergenic
No off target data available for this crispr