ID: 1022869791

View in Genome Browser
Species Human (GRCh38)
Location 7:34464206-34464228
Sequence TGCAGCCCACACTTAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022869784_1022869791 16 Left 1022869784 7:34464167-34464189 CCCCATTTCTATGCTGCACTCTG No data
Right 1022869791 7:34464206-34464228 TGCAGCCCACACTTAGTGGGTGG No data
1022869785_1022869791 15 Left 1022869785 7:34464168-34464190 CCCATTTCTATGCTGCACTCTGG No data
Right 1022869791 7:34464206-34464228 TGCAGCCCACACTTAGTGGGTGG No data
1022869783_1022869791 17 Left 1022869783 7:34464166-34464188 CCCCCATTTCTATGCTGCACTCT No data
Right 1022869791 7:34464206-34464228 TGCAGCCCACACTTAGTGGGTGG No data
1022869787_1022869791 14 Left 1022869787 7:34464169-34464191 CCATTTCTATGCTGCACTCTGGA No data
Right 1022869791 7:34464206-34464228 TGCAGCCCACACTTAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022869791 Original CRISPR TGCAGCCCACACTTAGTGGG TGG Intergenic
No off target data available for this crispr