ID: 1022873783

View in Genome Browser
Species Human (GRCh38)
Location 7:34506832-34506854
Sequence CCCCACCACGCGTCAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022873783_1022873789 26 Left 1022873783 7:34506832-34506854 CCCACAGCTGACGCGTGGTGGGG No data
Right 1022873789 7:34506881-34506903 CAGTAATTCTTCTCTGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022873783 Original CRISPR CCCCACCACGCGTCAGCTGT GGG (reversed) Intergenic