ID: 1022873789

View in Genome Browser
Species Human (GRCh38)
Location 7:34506881-34506903
Sequence CAGTAATTCTTCTCTGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022873783_1022873789 26 Left 1022873783 7:34506832-34506854 CCCACAGCTGACGCGTGGTGGGG No data
Right 1022873789 7:34506881-34506903 CAGTAATTCTTCTCTGAATGAGG No data
1022873785_1022873789 25 Left 1022873785 7:34506833-34506855 CCACAGCTGACGCGTGGTGGGGC No data
Right 1022873789 7:34506881-34506903 CAGTAATTCTTCTCTGAATGAGG No data
1022873787_1022873789 3 Left 1022873787 7:34506855-34506877 CCAACACAGGCTTTCTTTCCTGC No data
Right 1022873789 7:34506881-34506903 CAGTAATTCTTCTCTGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022873789 Original CRISPR CAGTAATTCTTCTCTGAATG AGG Intergenic