ID: 1022873789 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:34506881-34506903 |
| Sequence | CAGTAATTCTTCTCTGAATG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022873783_1022873789 | 26 | Left | 1022873783 | 7:34506832-34506854 | CCCACAGCTGACGCGTGGTGGGG | No data | ||
| Right | 1022873789 | 7:34506881-34506903 | CAGTAATTCTTCTCTGAATGAGG | No data | ||||
| 1022873785_1022873789 | 25 | Left | 1022873785 | 7:34506833-34506855 | CCACAGCTGACGCGTGGTGGGGC | No data | ||
| Right | 1022873789 | 7:34506881-34506903 | CAGTAATTCTTCTCTGAATGAGG | No data | ||||
| 1022873787_1022873789 | 3 | Left | 1022873787 | 7:34506855-34506877 | CCAACACAGGCTTTCTTTCCTGC | No data | ||
| Right | 1022873789 | 7:34506881-34506903 | CAGTAATTCTTCTCTGAATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022873789 | Original CRISPR | CAGTAATTCTTCTCTGAATG AGG | Intergenic | ||