ID: 1022873885

View in Genome Browser
Species Human (GRCh38)
Location 7:34507904-34507926
Sequence GTAGAGAAGGGGAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022873885_1022873893 4 Left 1022873885 7:34507904-34507926 CCCTCCCCTTTCCCCTTCTCTAC No data
Right 1022873893 7:34507931-34507953 CATTCTCTCTAGAAGATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022873885 Original CRISPR GTAGAGAAGGGGAAAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr