ID: 1022877877

View in Genome Browser
Species Human (GRCh38)
Location 7:34553345-34553367
Sequence GGTCACAACACTCCAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 4, 1: 21, 2: 67, 3: 78, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022877877_1022877886 16 Left 1022877877 7:34553345-34553367 CCACCCATTGGAGTGTTGTGACC 0: 4
1: 21
2: 67
3: 78
4: 164
Right 1022877886 7:34553384-34553406 CTTGGCCCCTCCAACACTACAGG No data
1022877877_1022877884 -2 Left 1022877877 7:34553345-34553367 CCACCCATTGGAGTGTTGTGACC 0: 4
1: 21
2: 67
3: 78
4: 164
Right 1022877884 7:34553366-34553388 CCAGTGGTCTGGGAGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022877877 Original CRISPR GGTCACAACACTCCAATGGG TGG (reversed) Intergenic
902230122 1:15022462-15022484 GGTCACAACAAGCAAATGGTAGG + Intronic
904055422 1:27666878-27666900 GGCCACACCCCTGCAATGGGAGG - Intronic
905538953 1:38745031-38745053 GGTCAGGACACTCAAATGGTGGG + Intergenic
907027165 1:51131849-51131871 GGTCACTACACTCTAATGGGTGG - Intronic
908115354 1:60935052-60935074 GTTCACGACACTCCTATGGCTGG + Intronic
908667720 1:66510800-66510822 GGTCATTACCCTCCAATGGGTGG - Intergenic
908785677 1:67732525-67732547 GAACAAAACACTCCATTGGGAGG + Intronic
908818613 1:68058936-68058958 GGTCACTACATTCCAGTGCGTGG - Intergenic
908864450 1:68530876-68530898 GACAAAAACACTCCAATGGGAGG - Intergenic
908935666 1:69373352-69373374 GGTCACAACATTCTGATGGGCGG + Intergenic
909024710 1:70468593-70468615 GGTCACTACACTTTGATGGGTGG - Intergenic
909203709 1:72725900-72725922 GGTCACTACACTCCAATGGATGG - Intergenic
909264352 1:73537515-73537537 GGCCATAGCACTCTAATGGGTGG + Intergenic
910657154 1:89631464-89631486 GGTCACAACCCTCCTGTGGAGGG - Intergenic
911311529 1:96297842-96297864 GGTCACTACACTCCAATGAGTGG + Intergenic
912594832 1:110864313-110864335 GGCCACAACACTCCAATGGGTGG - Intergenic
912710258 1:111944776-111944798 GGTGATTACACTCCAAGGGGAGG + Intronic
912887378 1:113489125-113489147 GGTCACTACACTCTGATAGGTGG - Intronic
913179533 1:116308131-116308153 GGACAGAACACTTCAATGGCAGG + Intergenic
913349660 1:117843187-117843209 GGTCACTACACTTCAATGGGTGG - Intergenic
915052005 1:153084771-153084793 GTTCACTACACTCTGATGGGTGG - Intergenic
915053615 1:153103761-153103783 GTTCACTACACTCTGATGGGTGG - Intronic
915709197 1:157878039-157878061 GGTAAAATCACTCCAAAGGGCGG - Intronic
916048820 1:161020794-161020816 GGTCACAACTCACCAGTGTGGGG + Intronic
916392158 1:164342525-164342547 GGCAACAACACTCCAATGGGAGG - Intergenic
917524530 1:175775243-175775265 GGTCACAACAATCTGATGGGTGG - Intergenic
917696613 1:177532309-177532331 GGTAACAACACTATGATGGGTGG - Intergenic
917887196 1:179398392-179398414 GGTCACTACACTCTGTTGGGTGG + Intronic
918826993 1:189336967-189336989 GGCCACAACACTCTGAAGGGTGG - Intergenic
918949052 1:191110999-191111021 GGGCACAACATTGCAATGGGTGG + Intergenic
919568396 1:199218074-199218096 GGTCACTACTCTCCAATAGGTGG + Intergenic
921104281 1:211960050-211960072 GGTTACTACACTCCAATGGGTGG - Intronic
921767530 1:218990073-218990095 GGTCACAACATTCTGCTGGGTGG + Intergenic
921777021 1:219112634-219112656 GGTTGCTACACTCCAATGGGTGG - Intergenic
921800624 1:219398953-219398975 AGTCACTACACTCCAATGGATGG + Intergenic
1063275115 10:4557566-4557588 GGTCACTCCACTCCAAAGGGTGG + Intergenic
1063819766 10:9820398-9820420 AGTCACTACACTTCCATGGGTGG - Intergenic
1068285536 10:54929325-54929347 GGTCACTACACTTCAATGGGTGG + Intronic
1069314962 10:67086912-67086934 AGTCACAACAGTCCACTGGAGGG - Intronic
1069334025 10:67327638-67327660 GGTCAGTACACTCCAACGGGTGG + Intronic
1069805896 10:71124868-71124890 GGTCACTACACTCCAATGGGTGG + Intergenic
1071191806 10:83109523-83109545 GGCCACTACACTCTGATGGGTGG - Intergenic
1071358010 10:84817867-84817889 GGCCACAACACTCTAATGGGTGG + Intergenic
1071772472 10:88744389-88744411 GGCAACAACACTCTGATGGGAGG - Intronic
1072839332 10:98753597-98753619 GGCCACAACACTCTGATGGAAGG - Intronic
1076829096 10:132985402-132985424 GGTCACAACAGCCCTGTGGGTGG - Intergenic
1078517312 11:12033812-12033834 GGCCACAATATTCCAATAGGTGG - Intergenic
1083006419 11:59351004-59351026 GGTCACTACACTCTGATGGGTGG + Intergenic
1084925768 11:72510331-72510353 GGCCACAACACTCCAATGAGTGG + Intergenic
1085731456 11:79002398-79002420 GGCCACAACACTCCAATGGGTGG - Intronic
1085812810 11:79700718-79700740 GGTCACAACACTCTGATTGGTGG - Intergenic
1085856374 11:80180985-80181007 GGTCACTACACTTCTATGGGTGG + Intergenic
1086760155 11:90619971-90619993 GGTCTGTACACTCCAATTGGTGG - Intergenic
1087309787 11:96528081-96528103 GGTCACTACACTCTGATGAGTGG - Intergenic
1087868776 11:103266112-103266134 GGTCACTACACTGCGATAGGTGG + Intronic
1090162432 11:124509984-124510006 GGTCACTACACTCTGATGGGTGG + Intergenic
1090217570 11:124983680-124983702 GGTCACAACACACTGATGGATGG + Intronic
1090684585 11:129100983-129101005 GGTCACTACACTCCAATGGGTGG - Intronic
1091529228 12:1338950-1338972 GGTCACTACACTCTAATGGGTGG + Intronic
1092333694 12:7608882-7608904 GGTCACAACACTTTGATGGATGG - Intergenic
1093490789 12:19701519-19701541 GGCCACAACACTCCAATGAAGGG - Intronic
1093655387 12:21688226-21688248 GCTGACAACACTCTGATGGGGGG - Intronic
1094289703 12:28833340-28833362 GGTCACAACACTCTGATGGGGGG - Intergenic
1094523419 12:31216277-31216299 GGTCACAGCATTCTGATGGGTGG - Intergenic
1098777701 12:74641982-74642004 GACCACAACACTCCAAAGAGTGG - Intergenic
1099394613 12:82121824-82121846 GGTCAAAACACTCCAATGGGTGG - Intergenic
1101471146 12:104998582-104998604 GGTCAGAACACTTCAATGGGTGG + Intronic
1105239014 13:18593580-18593602 CTTCACAACAATCAAATGGGTGG + Intergenic
1107389200 13:39945575-39945597 GGTCACAACACTCTCATGGGTGG - Intergenic
1107421477 13:40251395-40251417 GTTCACAACACACCCATGAGAGG + Intergenic
1108775683 13:53762188-53762210 GGTCACAATACTCTGATGGGTGG - Intergenic
1109423641 13:62145603-62145625 GGTCACACTGGTCCAATGGGTGG + Intergenic
1109476557 13:62886954-62886976 GGCCACAACAATCCAATGGGTGG + Intergenic
1109569229 13:64164432-64164454 GGCCACAACACTCTGATGGATGG + Intergenic
1111274998 13:85936501-85936523 AGTGATAACACTCTAATGGGTGG - Intergenic
1114933572 14:27506320-27506342 GGTCACTACACTTCAATGGGTGG + Intergenic
1116336775 14:43666468-43666490 GCTCACTACACTCTGATGGGTGG - Intergenic
1117638837 14:57775385-57775407 GGTTCCAAGACTCCAATGGCTGG - Intronic
1118448723 14:65877208-65877230 GGTCACTACACTCCGATGGGTGG + Intergenic
1118478663 14:66142125-66142147 GGCCACTACACTCTGATGGGTGG - Intergenic
1121484631 14:94305171-94305193 GCTCACAACACCCTAAGGGGTGG + Intronic
1123721388 15:23064636-23064658 ACCCCCAACACTCCAATGGGGGG - Intergenic
1123875656 15:24621603-24621625 GGCCAGAACACTCCAATGGGTGG + Intergenic
1127288073 15:57547717-57547739 TCTCACAACACCCCAGTGGGTGG - Exonic
1128968534 15:72086044-72086066 TGTCACTACACTCCAGCGGGTGG + Intronic
1129570902 15:76682647-76682669 GACCACAACACTCTAATGGGTGG - Intronic
1129572152 15:76699725-76699747 GGCAACAACACTTCAATGGCGGG + Intronic
1129931270 15:79412806-79412828 GGTCACAACACTCCAATGGGTGG - Intronic
1131590956 15:93747435-93747457 GGTCTGAACACTCCTTTGGGTGG - Intergenic
1132042372 15:98536119-98536141 GGCCACAACACTCCAGTGGGGGG - Intergenic
1136931910 16:34426199-34426221 GGCCACAACACTCTGATGGGTGG + Intergenic
1136972662 16:34985616-34985638 GGCCACAACACTCTGATGGGTGG - Intergenic
1138458356 16:57133832-57133854 CCTCACAACACCCCAATGGAAGG - Intronic
1138976415 16:62213824-62213846 GGTCACCACACTCCAATGGGTGG + Intergenic
1140148189 16:72332900-72332922 GGTCATTACACTTTAATGGGTGG + Intergenic
1141053590 16:80795469-80795491 GGTCACACCACTCCAGTGAAAGG - Intronic
1141307300 16:82877562-82877584 GGTAACAGCAATGCAATGGGGGG + Intronic
1142021263 16:87784158-87784180 GGTCACAACACGACGATGGGAGG - Intergenic
1143390682 17:6557412-6557434 GGTAACAACCCTCCACTGAGAGG + Intergenic
1149015240 17:51901410-51901432 AGCCACAATACTCCAATAGGGGG + Intronic
1150533702 17:66013632-66013654 GGCCACAACACTCCAACGAGTGG + Intronic
1150940502 17:69688055-69688077 GGTCACAACACTCTGATGGGTGG + Intergenic
1154019277 18:10648335-10648357 GGTCACTACACTCCAATGGGTGG - Intergenic
1154184941 18:12174898-12174920 GGTCACTACACTCCAATGGGTGG + Intergenic
1155844958 18:30694840-30694862 GGTCACAACACTCCAGTGGATGG + Intergenic
1159170396 18:64758844-64758866 AGCCACACCACTCCAATGGGTGG - Intergenic
1159905971 18:74092782-74092804 GGTCACAACACTCTGATGGGTGG + Intronic
1163265225 19:16216835-16216857 GGTCACAACACTCCAATGGGTGG + Intronic
1166585934 19:43949055-43949077 GGTCACTGCACTACAATGGATGG + Intergenic
925017153 2:538849-538871 GGCAACAATACTCCAAAGGGGGG - Intergenic
927194258 2:20537030-20537052 GATCTCAACTCTCCAAAGGGAGG + Intergenic
930930474 2:56875624-56875646 GGTCACCAAACTCCAATGGATGG - Intergenic
931397018 2:61896533-61896555 GATCACACCACTGCACTGGGTGG + Intronic
931921259 2:67018555-67018577 TGCCACAACACTCCAATGGGTGG - Intergenic
932853489 2:75210518-75210540 GGCCACAACACTCTGATGAGTGG + Intergenic
933173712 2:79154525-79154547 GGCCACAACACTCCAGTAAGTGG + Intergenic
933555171 2:83822989-83823011 GGTCACTACACTCTGATGGGTGG + Intergenic
934099788 2:88641619-88641641 CGTCACTACACTGCAATAGGTGG - Intergenic
934219023 2:90064625-90064647 GGTCACAACACTTCTGTGGGTGG + Intergenic
934996553 2:98967047-98967069 GGTCACAACACTACAATGGCTGG + Intergenic
936812110 2:116414176-116414198 GGCCACAACACTCCAGTGGGTGG - Intergenic
939089119 2:137757980-137758002 GGTCACAGCACCTCAAAGGGTGG - Intergenic
940990990 2:160096357-160096379 GCTCACAACAACCCTATGGGGGG - Intergenic
941054996 2:160777231-160777253 GGCAACAACACTCCAATGGAGGG - Intergenic
942855460 2:180541057-180541079 GTTCAAAACACTGCAATGGCTGG - Intergenic
943386491 2:187208756-187208778 GGTCCCTACACTTCCATGGGTGG - Intergenic
943667605 2:190626572-190626594 TGTGACAACACTCCTGTGGGTGG + Intergenic
944436599 2:199696391-199696413 GGCAACAACACTTCAATGGCAGG - Intergenic
945487678 2:210416938-210416960 GGCAACAACACTCTAATGTGGGG + Intergenic
946103653 2:217350923-217350945 GGTCAGCACACTCCAACAGGTGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1169497444 20:6128972-6128994 GTCCACTCCACTCCAATGGGGGG - Intergenic
1173110417 20:40182383-40182405 GGTCACAGCACTAAAAAGGGTGG - Intergenic
1173194137 20:40900114-40900136 TCCCACATCACTCCAATGGGAGG + Intergenic
1174091939 20:48056214-48056236 GGTAACCACCCTCCAATGGCTGG + Intergenic
1174324122 20:49765565-49765587 GGTAACAATACACCAATAGGTGG + Intergenic
1176783009 21:13221841-13221863 CTTCACAACAATCAAATGGGTGG + Intergenic
1177043790 21:16145495-16145517 GGTCACTACACTTCAATGAGTGG + Intergenic
1177980650 21:27910638-27910660 CTTCACAACAATCAAATGGGTGG + Intergenic
1178060510 21:28849089-28849111 GGCCACAACACTCTGATGGGTGG - Intergenic
1181769339 22:25113982-25114004 GGTCACACCACTCCCCAGGGTGG - Intronic
1184527450 22:45033590-45033612 GGTCACAACTCACCTTTGGGTGG + Intergenic
1184528152 22:45037658-45037680 GGTGACAGCATTCCAATGGCAGG + Intergenic
949594737 3:5531886-5531908 GGTTATAACACTCTGATGGGGGG + Intergenic
949743499 3:7263327-7263349 GGTCACAACACTTAGATGGGTGG + Intronic
951822525 3:26828007-26828029 GGTCACTACACTCTGATGGGTGG - Intergenic
953104336 3:39861081-39861103 GGTCACAACACCCTTATGGGTGG - Intronic
954509229 3:51106949-51106971 GGTCACAACACTCTGCTGGGTGG - Intronic
956371886 3:68571662-68571684 AGTCACAATACTCCAATGGGTGG - Intergenic
959041286 3:101425250-101425272 GGTCACTACTCTCCAATGGGTGG - Intronic
959169881 3:102831314-102831336 GGTCACAACACTTCAATGGTTGG - Intergenic
959291097 3:104475215-104475237 GTTCACAACACTCTGATGGGTGG - Intergenic
959421696 3:106136268-106136290 GGTCACTACATTCCAATGGGTGG - Intergenic
960012659 3:112850021-112850043 GGTTACAACACTCTAATGGGTGG - Intergenic
961988147 3:131158876-131158898 GGTCACTACACTCTGATGGATGG - Intronic
962335504 3:134527010-134527032 AGTCACTACACCACAATGGGTGG + Intronic
962350452 3:134652003-134652025 GGTCCATACACTCCAATGCGGGG - Intronic
962655630 3:137541893-137541915 GGCCACAACATTCCAATAGGTGG + Intergenic
962735293 3:138320197-138320219 GTTCACAACACTCAGATGAGAGG - Intronic
963615263 3:147528653-147528675 GGCCACAACATTCAGATGGGTGG + Intergenic
964142809 3:153422563-153422585 GGTCACTACACTCTGATGGGTGG - Intergenic
964296434 3:155239409-155239431 GGTCACAACACTCCAATAGGTGG + Intergenic
965181940 3:165415154-165415176 GGTCACTACACTCTAATAGGTGG - Intergenic
966490048 3:180517206-180517228 ACTCATTACACTCCAATGGGTGG - Intergenic
966714191 3:182999805-182999827 GGTCACTACACTCTGATGGATGG + Intergenic
970221192 4:13813180-13813202 GGTCTCAAGACTCCAAGGGAGGG - Intergenic
971884927 4:32432232-32432254 GGTCACAACATTCCAAGGGGTGG - Intergenic
973073098 4:45889740-45889762 GGCCTCAACACTCTGATGGGTGG + Intergenic
973673722 4:53242220-53242242 GGTCACAACACTCTGATGGGTGG - Intronic
973849731 4:54949071-54949093 GGTCACACCACTCCAATCATTGG + Intergenic
974723653 4:65773069-65773091 GGTCACTACACTCCAATAGGTGG + Intergenic
975899152 4:79129549-79129571 GGTCATAGCACCCCAATTGGTGG + Intergenic
975909351 4:79248948-79248970 CATCACAACATTCCAATGGGTGG - Intronic
976948407 4:90798906-90798928 GGTCACAACACTCTGATGGGTGG + Intronic
977696590 4:99972325-99972347 ATTCACAACACTCCAATGGGTGG - Intergenic
978241402 4:106521021-106521043 GTTCACAGCACTCTGATGGGTGG + Intergenic
978689014 4:111484110-111484132 GGTCACTACACTACAATGGGTGG - Intergenic
979158495 4:117429092-117429114 AGTTACTACACTCCAATGGATGG + Intergenic
980257563 4:130402302-130402324 GGTCACTACACTATGATGGGTGG + Intergenic
981454008 4:144932977-144932999 GGTCACTACACTTCTATGGGTGG + Intergenic
981466296 4:145076185-145076207 GGCAACAACACTCCAATGAGGGG - Intronic
982878980 4:160686501-160686523 GGTCACAACACTCTGATGGGTGG - Intergenic
983413419 4:167425437-167425459 GGCCACAACACTCTGATGGGTGG - Intergenic
985395529 4:189539245-189539267 GGCAACAACACTCCAATCAGAGG - Intergenic
986229498 5:5849833-5849855 GGCAACAACACTCCGATGGGGGG - Intergenic
986244772 5:5997508-5997530 GGCAACAACACTCCAATAGAGGG + Intergenic
986254193 5:6088135-6088157 GGTCACCTCACCCTAATGGGGGG + Intergenic
986754513 5:10823370-10823392 GGTCACTACACTCTGATGAGTGG + Intergenic
987193291 5:15500509-15500531 GGTCCCCGCACTCCAGTGGGAGG - Exonic
989216411 5:38908502-38908524 GGCCACAAAACTCCAATGAGTGG - Intronic
989481771 5:41939120-41939142 GGTCCAAACACTCCAATAGAAGG + Intronic
993228682 5:85204133-85204155 GGCCACAATACTCCTATGGGTGG + Intergenic
994358947 5:98828135-98828157 GGTCACTGCACTCTGATGGGTGG - Intergenic
994573016 5:101537813-101537835 GGCCACAACACTTCAATGGTTGG - Intergenic
994613822 5:102078508-102078530 AGGCACAACACTCTGATGGGTGG - Intergenic
994643002 5:102433662-102433684 GGTCACAACACTCCAATGGACGG + Intronic
994970574 5:106731365-106731387 GGTTATAACACTCTGATGGGTGG - Intergenic
995488070 5:112659053-112659075 GGCCACAACACTCCAATGAGTGG - Intergenic
995896161 5:117013495-117013517 GGTCACTACACTCTGATGGGTGG + Intergenic
996245802 5:121262979-121263001 GGCCAGAGCATTCCAATGGGTGG + Intergenic
997021551 5:130008230-130008252 GGCAACAACACTCCAATGGGGGG - Intronic
997182154 5:131841260-131841282 GGTCTCTACAATCCAATGGGTGG + Intronic
997188070 5:131901583-131901605 GGTCACAGCACTCTGATGAGTGG - Intronic
998504063 5:142657867-142657889 GGACACCACACTCCAAAAGGTGG - Intronic
998755893 5:145379230-145379252 GGTCACTGCACTCCAATGGGTGG + Intergenic
1000521453 5:162299808-162299830 GGTAACAACACTCTGATGGGGGG + Intergenic
1001851380 5:174969863-174969885 GGCCACAACACTCTGATGAGGGG + Intergenic
1004090463 6:12495004-12495026 GGTCACAACATTCTGATGGGTGG - Intergenic
1004169318 6:13283674-13283696 GGTCTCAACACTCCATTATGGGG - Intronic
1004834100 6:19511426-19511448 GGTCACTACACTCCAATGAGTGG + Intergenic
1006253064 6:32807121-32807143 GGTCACTACACTCCAATGAGTGG + Intergenic
1007353788 6:41295042-41295064 GGTCATGACACTCTGATGGGTGG - Intergenic
1010177956 6:73051458-73051480 GGCCACAATACTCTGATGGGTGG - Intronic
1012668928 6:102015738-102015760 GGTCACAACACTCTGAAGGGTGG - Intronic
1014854402 6:126381736-126381758 GGTCACAACACTATGATGGGCGG - Intergenic
1015246927 6:131085333-131085355 GGTCACTACACTTCAATGGGTGG - Intergenic
1016075251 6:139788266-139788288 TGTCACAACACTCTGATGGGTGG + Intergenic
1016237694 6:141887819-141887841 GTCCACAACACTCCAATTGGTGG - Intergenic
1016453556 6:144209091-144209113 GGTCACTACACTCCAGTTGGTGG + Intergenic
1016663702 6:146610744-146610766 GGCAACAACACTCCAATGGGGGG + Intronic
1017789291 6:157782019-157782041 GGCCACAAAACTCCCCTGGGAGG - Intronic
1018603663 6:165575208-165575230 GGTCACAAAACTCGAATGATTGG - Intronic
1021425710 7:20496689-20496711 GGTCACAACACTTCAATGGGTGG - Intergenic
1022486083 7:30778747-30778769 ACACACAACACGCCAATGGGCGG - Intronic
1022877877 7:34553345-34553367 GGTCACAACACTCCAATGGGTGG - Intergenic
1024385564 7:48748173-48748195 GGTCATAACACTTCGAAGGGCGG + Intergenic
1028177373 7:87674111-87674133 GGTCACAATACTCCTATGGGTGG + Intronic
1028336753 7:89667637-89667659 GGTCACTACACTCTGAGGGGTGG - Intergenic
1028639926 7:93030284-93030306 GGGCACAACACTGCAATGAGTGG - Intergenic
1031294452 7:119983899-119983921 GGTCACAACACTCTGATGGGTGG - Intergenic
1031702793 7:124945552-124945574 GTTCATAGCACTCCAATAGGTGG - Intergenic
1033442587 7:141393829-141393851 GGTTACAACACTCCATTGTGGGG + Intronic
1034366360 7:150551887-150551909 GGTAACAACACTCCAATGAGTGG - Intergenic
1035864665 8:3069558-3069580 GGGCACACCACTACAAGGGGTGG + Intronic
1037155566 8:15694822-15694844 GGTCACAACACTCCCATGAGTGG + Intronic
1037373496 8:18205082-18205104 GGTCACTACACTCCGATGGGTGG + Intronic
1038360712 8:26873154-26873176 GGTCACAATTCACCAATGAGAGG - Intergenic
1039289427 8:36077773-36077795 GGTTACTACCCTCCAATGGGTGG - Intergenic
1039638558 8:39193899-39193921 GGCCACAACATTCCAATAGGTGG + Intronic
1040760274 8:50833170-50833192 GGTCACAACACTCGGATGGGTGG - Intergenic
1041005211 8:53491509-53491531 GGACACAACACTCCAATCTCTGG + Intergenic
1041429147 8:57759303-57759325 GGCCACAACACTCCAATGGGTGG - Intergenic
1041911694 8:63095744-63095766 GGTCATAAGACTCAAATGGAAGG + Intergenic
1042752155 8:72170113-72170135 GGCCACAACACTCTGATGGGTGG + Intergenic
1042976633 8:74477690-74477712 GGTCACAACACTCTAATGGGTGG + Intronic
1043131802 8:76472103-76472125 GGCCACAACACTTCAATGGGTGG + Intergenic
1043656645 8:82675068-82675090 GATCACTACACTCCAATGGGTGG - Intergenic
1043738418 8:83775837-83775859 GGTCACAACACTCCCATGGGTGG - Intergenic
1044793588 8:95872882-95872904 GGTCACTACACTCTAATGGGTGG - Intergenic
1046895222 8:119464244-119464266 GGTTACTGCACTCCAGTGGGTGG - Intergenic
1047168639 8:122467468-122467490 GGTCACTACATTCTGATGGGTGG - Intergenic
1048029396 8:130616682-130616704 GGTCACTACACTCCAATGGATGG - Intergenic
1048119381 8:131563045-131563067 GGTCACAATGCTACAATGGGTGG + Intergenic
1048727322 8:137401041-137401063 GGCCACCACACTCCAAAAGGTGG - Intergenic
1048879654 8:138861785-138861807 GGTCAAACTGCTCCAATGGGTGG + Intronic
1049128202 8:140811142-140811164 GGTCACTACACTCCAATGGGTGG - Intronic
1049506962 8:143007982-143008004 GGTCACTACACTCTGATAGGTGG + Intergenic
1050475418 9:6035344-6035366 GGTCACAACACTGTGATGGATGG - Intergenic
1051110335 9:13627897-13627919 AGTCACGACACTCCAATGGGTGG - Intergenic
1051819578 9:21149361-21149383 GGCAACAGCACTCCAATGAGGGG + Intergenic
1051832529 9:21296251-21296273 GGTCAGAACACTCTGATAGGTGG - Intergenic
1052173411 9:25428293-25428315 GGTCACAGCACTCTGATGAGTGG - Intergenic
1052591187 9:30497757-30497779 GGTTACAACATTCCGATGGGTGG + Intergenic
1053542837 9:38993074-38993096 GGTCACAACACTCTGATGGGTGG + Intergenic
1053807283 9:41816591-41816613 GGTCACAACACTCTGATGGGTGG + Intergenic
1054623309 9:67370836-67370858 GGTCACAACACTCTGATGGGTGG - Intergenic
1054965999 9:71027058-71027080 GGTCACAACACTTTGATGGGTGG - Intronic
1056572624 9:87828878-87828900 GGTCACAACACTTGTATGGGTGG - Intergenic
1057638479 9:96794825-96794847 GGTCACAACACTCTGATGGGAGG + Intergenic
1057980012 9:99650884-99650906 GCTCACAACGCTCCCATAGGTGG - Intergenic
1060017500 9:120099271-120099293 GGTCACTACTCTCCCATTGGTGG - Intergenic
1061730578 9:132610920-132610942 GGTCACTTCCCTCCACTGGGTGG + Intronic
1187220739 X:17323589-17323611 TGCCACTACACTCCAGTGGGTGG - Intergenic
1187614911 X:20982194-20982216 AGCAACAACACTCCACTGGGAGG - Intergenic
1187644242 X:21329038-21329060 GGTCACAACTTTCCAATTGGTGG - Intergenic
1188493148 X:30756696-30756718 TGTCACAACACTCTGATGGATGG - Intergenic
1188748576 X:33877716-33877738 GGTAACAAAACTCCAGTTGGTGG + Intergenic
1188797100 X:34480927-34480949 GGTCACAACACTTCAATGGGTGG + Intergenic
1188837727 X:34978731-34978753 GGCCACAACACTCCAATGGGTGG - Intergenic
1188905584 X:35787246-35787268 GGACACAAGACTCCAGAGGGGGG + Intergenic
1188921620 X:35985273-35985295 GGCCACAACATTCCTATTGGGGG + Intronic
1189558035 X:42165636-42165658 GGTCACAACACTCCAATGGGTGG + Intergenic
1190506343 X:51129995-51130017 GGTCACTCCACTCTGATGGGTGG + Intergenic
1191038774 X:56056896-56056918 GGTCACTAGACTCTGATGGGTGG + Intergenic
1191207801 X:57852976-57852998 GTTCAAAACACTCCGATGGGTGG + Intergenic
1191654181 X:63577698-63577720 GGTCACAACACTCTGAATGGTGG - Intergenic
1191722710 X:64248138-64248160 GGCCACAACACTCTAAAGGCTGG + Intergenic
1191729012 X:64314178-64314200 GGTCACTACACTCTAATGAGTGG + Intronic
1191816841 X:65254297-65254319 GGCCACAACAGTGCAATGGCTGG - Intergenic
1191823708 X:65340446-65340468 GGTAACTACACTCTGATGGGTGG - Intergenic
1192766738 X:74147219-74147241 GGTCACAATACTCCAATGGCTGG - Intergenic
1192927894 X:75776014-75776036 GGTTACAACACTCCAATGGGTGG + Intergenic
1193250868 X:79289305-79289327 GCACACAGCAATCCAATGGGTGG - Intergenic
1193270039 X:79517961-79517983 GGAAACAACACTCTAATGGGAGG - Intergenic
1193401950 X:81055477-81055499 GGCCACAACACTCCCATGGTGGG - Intergenic
1193494701 X:82196957-82196979 GTTCACAATACTGCAATTGGTGG + Intergenic
1193518770 X:82503334-82503356 GGCCACAACATTCCAATAGGTGG + Intergenic
1193557479 X:82973908-82973930 GGTCACAGAACTCCAATAGCTGG - Intergenic
1193635309 X:83943340-83943362 GGTCAGAACACTTAAATGGGTGG + Intergenic
1193638761 X:83985341-83985363 AGCCACAACACTCCAAAGGGTGG - Intergenic
1193749558 X:85326078-85326100 GGTCACAACACTCCTATGGGTGG + Intronic
1193823613 X:86195677-86195699 GCTCACTGCACTCCAAAGGGTGG - Intronic
1193894662 X:87098499-87098521 GGTCACAACACTATGATGTGTGG + Intergenic
1194344794 X:92750575-92750597 GGTCACAACATTCTCATGAGTGG + Intergenic
1194519476 X:94901286-94901308 GATCACAACACCCCAATGTGTGG + Intergenic
1194851528 X:98875815-98875837 GGCCACAAAACTCCAATGCATGG + Intergenic
1194872765 X:99153424-99153446 AGGAACAACACTCCAATGGGGGG - Intergenic
1195544464 X:106099923-106099945 GGTCACAACACTCCGATGGCTGG + Intergenic
1195567773 X:106362975-106362997 GGTCACTACATTCAGATGGGTGG + Intergenic
1195586198 X:106567530-106567552 GGTCACGACACTCCAATGGGTGG - Intergenic
1195834342 X:109095945-109095967 GGCCACAGCACTCTGATGGGTGG + Intergenic
1196584177 X:117409876-117409898 GGTCACAGCACTCCAATGGGTGG - Intergenic
1197141567 X:123122546-123122568 GGTCACAACACTCTAATAGGTGG - Intergenic
1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG + Intergenic
1197551515 X:127898104-127898126 GGTCACAACAGTCTAATTGGTGG - Intergenic
1197570779 X:128147759-128147781 GGTCACAATACTGTAATGGGTGG - Intergenic
1198758902 X:140011168-140011190 AGTCACAACAGTCCAATGGGCGG + Intergenic
1198779842 X:140222413-140222435 AGTCACAACAGTCCAATGGGCGG - Intergenic
1198890655 X:141392115-141392137 GGTCACAGCACTCTGATGGGTGG + Intergenic
1198891520 X:141402677-141402699 GGTCACTACACTCTGATGGTTGG + Intergenic
1199216606 X:145266360-145266382 GGTCACAATAATCCAATGGGTGG - Intergenic
1199407975 X:147485248-147485270 GGTAACAACACTCTGATGGGAGG + Intergenic
1199640849 X:149859282-149859304 GGTCACCACACTCCCATGAGTGG - Intergenic
1199707089 X:150437126-150437148 GGTCACAACACTGCAATGGATGG + Intronic
1199786550 X:151111690-151111712 GGCCACAGAACTCCAAAGGGTGG + Intergenic
1199786939 X:151114311-151114333 GTCCACAACACTCCAATGGGTGG + Intergenic
1200653140 Y:5867216-5867238 GGTCACAACATTCTAATGAGTGG + Intergenic
1200673874 Y:6127130-6127152 GGTCATGACAGTCCAATGTGTGG + Intergenic
1201247581 Y:12020997-12021019 CATCACAACACTCCACTGGCAGG - Intergenic
1201968276 Y:19762536-19762558 GGTCACAACACTCTAATGATTGG + Intergenic
1202168786 Y:22019193-22019215 GGACATAACTCCCCAATGGGAGG - Intergenic
1202222575 Y:22567175-22567197 GGACATAACTCCCCAATGGGAGG + Intergenic
1202320540 Y:23628485-23628507 GGACATAACTCCCCAATGGGAGG - Intergenic
1202550227 Y:26041571-26041593 GGACATAACTCCCCAATGGGAGG + Intergenic