ID: 1022882185

View in Genome Browser
Species Human (GRCh38)
Location 7:34599559-34599581
Sequence CCTAGGACATATTAGTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022882185_1022882191 1 Left 1022882185 7:34599559-34599581 CCCATGTACTAATATGTCCTAGG No data
Right 1022882191 7:34599583-34599605 CACTGCAGTCAACTTGCAAAGGG No data
1022882185_1022882194 29 Left 1022882185 7:34599559-34599581 CCCATGTACTAATATGTCCTAGG No data
Right 1022882194 7:34599611-34599633 GGAACATTTAACATTTTCAAGGG No data
1022882185_1022882193 28 Left 1022882185 7:34599559-34599581 CCCATGTACTAATATGTCCTAGG No data
Right 1022882193 7:34599610-34599632 TGGAACATTTAACATTTTCAAGG No data
1022882185_1022882190 0 Left 1022882185 7:34599559-34599581 CCCATGTACTAATATGTCCTAGG No data
Right 1022882190 7:34599582-34599604 GCACTGCAGTCAACTTGCAAAGG No data
1022882185_1022882192 8 Left 1022882185 7:34599559-34599581 CCCATGTACTAATATGTCCTAGG No data
Right 1022882192 7:34599590-34599612 GTCAACTTGCAAAGGGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022882185 Original CRISPR CCTAGGACATATTAGTACAT GGG (reversed) Intergenic
No off target data available for this crispr