ID: 1022885969

View in Genome Browser
Species Human (GRCh38)
Location 7:34643996-34644018
Sequence TGGTTGGAATTGCTAAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022885964_1022885969 28 Left 1022885964 7:34643945-34643967 CCAAGGGACATTTTGAGTGCCAA No data
Right 1022885969 7:34643996-34644018 TGGTTGGAATTGCTAAGGTCAGG No data
1022885965_1022885969 9 Left 1022885965 7:34643964-34643986 CCAATTCACTAATTTTACAGAAA No data
Right 1022885969 7:34643996-34644018 TGGTTGGAATTGCTAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022885969 Original CRISPR TGGTTGGAATTGCTAAGGTC AGG Intergenic
No off target data available for this crispr