ID: 1022889426

View in Genome Browser
Species Human (GRCh38)
Location 7:34681454-34681476
Sequence CAAGGTAAGTAGAGGTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022889418_1022889426 22 Left 1022889418 7:34681409-34681431 CCCTTCACCCTACATCCATGAAC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1022889426 7:34681454-34681476 CAAGGTAAGTAGAGGTATGCAGG No data
1022889422_1022889426 7 Left 1022889422 7:34681424-34681446 CCATGAACATGTTGCAACATCAG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1022889426 7:34681454-34681476 CAAGGTAAGTAGAGGTATGCAGG No data
1022889421_1022889426 14 Left 1022889421 7:34681417-34681439 CCTACATCCATGAACATGTTGCA 0: 1
1: 0
2: 4
3: 11
4: 158
Right 1022889426 7:34681454-34681476 CAAGGTAAGTAGAGGTATGCAGG No data
1022889420_1022889426 15 Left 1022889420 7:34681416-34681438 CCCTACATCCATGAACATGTTGC 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1022889426 7:34681454-34681476 CAAGGTAAGTAGAGGTATGCAGG No data
1022889419_1022889426 21 Left 1022889419 7:34681410-34681432 CCTTCACCCTACATCCATGAACA 0: 1
1: 0
2: 0
3: 10
4: 202
Right 1022889426 7:34681454-34681476 CAAGGTAAGTAGAGGTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022889426 Original CRISPR CAAGGTAAGTAGAGGTATGC AGG Intronic
No off target data available for this crispr