ID: 1022889547

View in Genome Browser
Species Human (GRCh38)
Location 7:34682352-34682374
Sequence CCCTGGGGGTGTCTAGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022889547_1022889558 23 Left 1022889547 7:34682352-34682374 CCTGAACCTAGACACCCCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1022889558 7:34682398-34682420 TATTATATTAGAACAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022889547 Original CRISPR CCCTGGGGGTGTCTAGGTTC AGG (reversed) Intronic
901664928 1:10820553-10820575 CCCTGGAGGTGTCTCTGCTCCGG + Intergenic
901932955 1:12608655-12608677 CACTGGGGGAGGTTAGGTTCTGG - Intronic
902242289 1:15096981-15097003 CCCTGGGGGTGTCTAAGGGTGGG - Intronic
902769924 1:18640003-18640025 TCCTGGGGGTGTCAAAGTCCAGG + Intronic
903261515 1:22134110-22134132 CCCTGCGGGTGTCCAGGTGGGGG + Intronic
905126393 1:35718754-35718776 CCCTGGTGGTGTCTAGTCCCTGG + Exonic
906313057 1:44767515-44767537 CCCTGGGGTTGTCCTGGCTCTGG + Exonic
906329756 1:44875506-44875528 CCCTGGGGCTGATGAGGTTCAGG + Intronic
906517206 1:46446763-46446785 CACTCGGGGTGTCCAGGTGCTGG + Intergenic
907660962 1:56392043-56392065 GCCTGGGGGTGTCTTGGGTCTGG + Intergenic
908322622 1:62992765-62992787 CTCTGGGGGTGTTCATGTTCTGG + Intergenic
910053734 1:83007095-83007117 CCCTGGGGAAGTCCAGGCTCAGG - Intergenic
912559905 1:110543281-110543303 CCCAGGGTGTGTCTTGGTTCTGG + Intergenic
915341133 1:155177395-155177417 CCCGTGAGGTGTCCAGGTTCTGG + Intronic
916012194 1:160716477-160716499 CTCTGGGGTTATCAAGGTTCTGG + Intergenic
917035240 1:170741599-170741621 CCCTGGGGCTGTCCTGGCTCTGG - Intergenic
919856501 1:201709733-201709755 CCTTGGGGGTGACCAGGATCTGG - Intronic
920060513 1:203223873-203223895 CCCTGGTGATGTCGATGTTCGGG - Intronic
1063947669 10:11193104-11193126 ATCTGGGGGTGTTTGGGTTCAGG - Intronic
1068410813 10:56651938-56651960 CCCTTGCTGTGTCTAGGTTTTGG - Intergenic
1069631119 10:69897524-69897546 CCCTGAAGGTTTGTAGGTTCTGG + Exonic
1072054532 10:91741018-91741040 CCCTAGGGGAGCATAGGTTCAGG + Intergenic
1076786315 10:132751708-132751730 CCCAGGAGGTGTCTGGGTGCAGG + Intronic
1076809031 10:132877178-132877200 GCCTGGGGGTGCCCAGGCTCAGG + Intronic
1077891041 11:6418732-6418754 CCCTCGGGGTGACTAGGGGCGGG - Intronic
1078020603 11:7653366-7653388 CCCTGAGGGTGGCCAGGATCTGG + Exonic
1081847550 11:46251802-46251824 CCCTTGGGCAGTCCAGGTTCTGG + Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084119105 11:67058645-67058667 CCCTGGGGTTGTATAGGTGCTGG + Intronic
1088049662 11:105496869-105496891 CCCTGGGGTTGTCTTGGCTGTGG + Intergenic
1096550311 12:52367796-52367818 GCCTGGGGGTGGCTGGGTTTGGG + Intergenic
1100240762 12:92708582-92708604 CCCTGGGGGTGACTTGGTCTAGG + Intergenic
1101784945 12:107874690-107874712 CCTTGGAGGTGCCTAGGTTGGGG + Intergenic
1102453043 12:113055846-113055868 GCCTGGGGGTGTTTAGATTGGGG - Intergenic
1104811256 12:131621561-131621583 CCCTGGGGGTGTGGTGGATCTGG - Intergenic
1108409635 13:50133431-50133453 CCCTTTGGATGTCTAGGGTCGGG + Intronic
1112342076 13:98560988-98561010 TCCTGGCTGTGTCTAGGCTCTGG - Intronic
1119179688 14:72597420-72597442 TCCTGGGGGTTTCCAGGTGCTGG - Intergenic
1121108601 14:91296728-91296750 CCCTGGGGCTGTCTAGGAGGTGG + Intronic
1121412745 14:93759336-93759358 AAATGGGGGTGTCTAGGTTTTGG - Intronic
1121521672 14:94590338-94590360 CCCTGGGGCTGTGTGGGTTTAGG - Intronic
1122505572 14:102229795-102229817 CCCTTGGGGTGTCTGGGACCTGG - Intronic
1122987425 14:105218946-105218968 TCTTGGGGGTGTCCAGGTTACGG - Intronic
1123030341 14:105448518-105448540 CCCTGGTGATGTCTGAGTTCAGG + Intronic
1124641093 15:31397197-31397219 CCAAGAGGGTGTCCAGGTTCAGG + Intronic
1127198230 15:56613922-56613944 CCCTGCCGATGTCTAGGTCCAGG + Intergenic
1129667599 15:77588223-77588245 CCAGGGTGGTGTGTAGGTTCTGG + Intergenic
1131094148 15:89645495-89645517 GCCTGGGGGTGGCTAGGCTGGGG - Intronic
1136345188 16:29670906-29670928 GCCTGGGGGTGTCTGGTTTGAGG + Intronic
1139421665 16:66853041-66853063 CCCAGCCAGTGTCTAGGTTCTGG - Intronic
1140189796 16:72805687-72805709 CCCAGTGGCTGTCTAGGTACAGG - Intronic
1142474407 17:180849-180871 CCCTGGGGGTGTCCCATTTCCGG - Intronic
1144252272 17:13429505-13429527 CCCTGGGGGTGTCTACGATCAGG - Intergenic
1147119609 17:38328260-38328282 CCCTGGGGGAGTGTGGGTCCAGG - Exonic
1147715443 17:42504581-42504603 ACCTGGAGGTGTCCAGGCTCTGG + Intronic
1150315993 17:64169442-64169464 ATCTGGGTGTGTCTAGGTTTGGG - Intronic
1152356765 17:79811326-79811348 CTCTGGGGCTGTCACGGTTCCGG + Intergenic
1159847945 18:73489051-73489073 TTCTGAGGGTGTCTGGGTTCTGG - Intergenic
1160364802 18:78314641-78314663 TCCTGGGTGTGTCCAGCTTCCGG - Intergenic
1161468994 19:4447046-4447068 CCCTGGGGGTGCCTCAGTGCTGG + Intronic
1162393613 19:10404005-10404027 CCCTGGGGGTGTCTAAATCGGGG + Intronic
1162796359 19:13089583-13089605 CCCAGGGGGTGGCAAGGCTCAGG - Intronic
1163510566 19:17732803-17732825 CCCTGGGGATGTCTATGTCCAGG + Intronic
1164991523 19:32687921-32687943 GCCTGGGGGTGTCCAGGCTCTGG + Intergenic
1166292665 19:41873066-41873088 CCCTTGGAGTGGCTAGGTCCAGG - Intergenic
1167597944 19:50437130-50437152 CCCTGAGGGTGTATGGGCTCTGG + Intronic
1168139279 19:54374489-54374511 CCCAGGGGTTGTCTGGGTTCAGG - Intergenic
1168158736 19:54493752-54493774 CCCAGAGGTTGTCTGGGTTCAGG + Intergenic
925023970 2:593712-593734 CCCTGGGGGTGCCCGGGTGCAGG - Intergenic
925987960 2:9231228-9231250 CCCTGGAGGTGACAAGGTCCTGG - Intronic
926138244 2:10352594-10352616 CCCTGGGGACGTCTGGGATCTGG + Intronic
926241854 2:11094609-11094631 CGTTGGGGGTGGCTGGGTTCAGG + Intergenic
932319286 2:70809242-70809264 CCCTGAGGGTGTCTGTGCTCAGG + Exonic
932399514 2:71470210-71470232 TCCTGGGGGTCTCTAGATTTGGG + Intronic
932416539 2:71576755-71576777 CCCTGGGGCTGGCTAGGGCCTGG + Intronic
934882031 2:97991556-97991578 CCCTGTGTGTGTCTAGCTGCTGG - Intronic
935694867 2:105762292-105762314 ACCAGGGGGGGTCTAGGTCCAGG + Intronic
937018900 2:118632926-118632948 CCCTGGGGGAGTCCAGGGGCTGG - Intergenic
941523003 2:166572071-166572093 CCCTGGGACTGGCTAGGTTTGGG + Intergenic
943110363 2:183597026-183597048 CTCTGGGGGTGTCTAGTTTTAGG + Intergenic
946255795 2:218440934-218440956 CCCTGCAGGTGACTAGGTGCTGG + Intronic
946369972 2:219274835-219274857 CCCTGGGGCTGGGTAGGTTCTGG - Intronic
947947457 2:234118539-234118561 CCCTGGGGGAGGCTAGCATCAGG + Intergenic
949060844 2:241956524-241956546 TGCTGGTGGTGTCTAGGGTCAGG - Intergenic
1172197922 20:33104685-33104707 CTCTGGGAGAGTCTAGGTTCTGG - Intronic
1173320290 20:41981670-41981692 TTCTGTGGGTGTCTATGTTCAGG - Intergenic
1174304489 20:49605486-49605508 CCCTCGGGCTGTCCATGTTCAGG - Intergenic
1175243724 20:57568562-57568584 GCCCGGGGGTGTCCAGGTTAGGG - Intergenic
1176446959 21:6829713-6829735 GCCTGGGGGTCTCTAAGTGCAGG + Intergenic
1176825130 21:13694739-13694761 GCCTGGGGGTCTCTAAGTGCAGG + Intergenic
1177923258 21:27181552-27181574 CCATGGAGGGGTCTAGGTTTGGG - Intergenic
1178979070 21:37245632-37245654 CCCTGGTGGAGTTTATGTTCAGG - Intronic
1179627359 21:42656211-42656233 CCCTGGGGGTCACTGGGTGCAGG + Intronic
1180174298 21:46080225-46080247 CCCTGGGGGTGTCAAGGGGTGGG + Intergenic
1180181690 21:46121076-46121098 CCCTGGGGGCCTCTGGGTCCAGG - Exonic
1183215206 22:36474900-36474922 GCCTGGAGGTGTCTGGGTTGGGG - Intronic
1183544335 22:38447578-38447600 TCCTGGGGGAGTCTAGGGTGGGG + Intronic
1183596913 22:38818333-38818355 CCCTGGGGCTGTCCAGGATCAGG + Intergenic
1183992078 22:41604043-41604065 CCCTGGGGGAGTCCCTGTTCCGG - Exonic
1184145719 22:42609141-42609163 CCCTGGGGGGGCCTCGGCTCTGG + Intronic
1184253042 22:43271727-43271749 GCCTGGGGGTGGCTGGGCTCGGG - Intronic
1184669742 22:46006462-46006484 CCCTGGGGGTGCCCTGGCTCTGG + Intergenic
950190481 3:10973076-10973098 CCTTTGGGGTGTCTTGCTTCTGG + Intergenic
953352962 3:42229851-42229873 CCCAGGTGGCATCTAGGTTCTGG - Intergenic
956059407 3:65334452-65334474 CCCTGGGGGTGTCCAGCTGGGGG + Intergenic
959003148 3:100988453-100988475 CCCTGGGGTTGCCTGGGCTCTGG + Intronic
959594538 3:108114829-108114851 CCCTGGGGATGAATAGATTCAGG - Intergenic
961808955 3:129510451-129510473 CCCTGAGGGGGTCTCGTTTCAGG - Intronic
962753509 3:138451546-138451568 TCCTGGGGGTTTCCAGGTTGGGG + Intronic
964473288 3:157076621-157076643 CCCTGCTGGTCTCTACGTTCTGG + Intergenic
968613426 4:1567193-1567215 CCCTGGGAGGGTCTGGGCTCTGG - Intergenic
968797288 4:2715748-2715770 CACATGGGGAGTCTAGGTTCTGG + Intronic
969665496 4:8554926-8554948 CCCTGGGGGTCGCTGGGGTCGGG - Intergenic
969683086 4:8653866-8653888 CCCTGGGCGTTCCTTGGTTCGGG + Intergenic
969717052 4:8872790-8872812 CCCTGGAGCTGTCTCCGTTCCGG + Intergenic
970518758 4:16861869-16861891 CCCCGCAGGTGTATAGGTTCGGG - Intronic
971196881 4:24478271-24478293 CCAGGGAGGTGTCTAGCTTCAGG - Intergenic
976102064 4:81575266-81575288 CCATCTGGGTGTGTAGGTTCGGG - Intronic
977868873 4:102065116-102065138 GCCTGGGAGTGTTTAAGTTCTGG + Intronic
986740575 5:10701739-10701761 CCCTGGGACGGTCTGGGTTCAGG + Intronic
987363309 5:17126073-17126095 GCCTGGGGCTGTCTACGTGCTGG - Intronic
992092409 5:73329017-73329039 CCCTGGGGGTGTTGAGGGTTAGG - Intergenic
997577836 5:134996520-134996542 CACTGGGGGTGTCATGGTGCTGG + Intronic
999874257 5:155784593-155784615 CCATGGGGCTGTGTTGGTTCTGG + Intergenic
1018043755 6:159948062-159948084 CCCAGGTGGTGCCTGGGTTCAGG + Intergenic
1019390973 7:786862-786884 CCTTGGGGGTGTCTGGGTAGGGG + Intergenic
1022889547 7:34682352-34682374 CCCTGGGGGTGTCTAGGTTCAGG - Intronic
1023847725 7:44132127-44132149 ACATGGGGGAGTCCAGGTTCAGG + Intergenic
1026123972 7:67563220-67563242 CCCTGGGGGTGGCTGGGGACTGG + Intergenic
1026512049 7:71035641-71035663 CTCTGCGGGTGTCTGGGCTCCGG - Intergenic
1026571601 7:71536307-71536329 CCATGGCTGTGTCTAGGGTCTGG - Intronic
1026907251 7:74069467-74069489 CCCTGGGGGAGTGTAGGATGGGG - Intronic
1027702420 7:81485223-81485245 TCCTGAGGGTGTCCAGGTTGAGG + Intergenic
1029172935 7:98643652-98643674 CCCTGAGGCATTCTAGGTTCTGG - Intergenic
1035369723 7:158372205-158372227 GCCTGGGGGTGTCCAGCTCCGGG - Intronic
1035369775 7:158372345-158372367 GCCTGGGGGTGTCCAGCTCCAGG - Intronic
1037878069 8:22558559-22558581 CCCTGGGGGTGCCTATGAGCTGG + Intronic
1039492303 8:37957063-37957085 CCCTGGTGGCTTCTAGCTTCTGG - Intergenic
1039595081 8:38784655-38784677 CCCTGGGGAAATCTAGTTTCTGG - Intronic
1040313465 8:46248828-46248850 CCCTGGGGGTTTCTGGGATGGGG - Intergenic
1041493349 8:58459811-58459833 ACCAGGGGGTGTATAGGTCCTGG + Intergenic
1047645901 8:126869360-126869382 CCCTGGGGGTGACATGGTTTTGG - Intergenic
1049615413 8:143573733-143573755 CCCTGGGGGTGCCTGGGGTGTGG + Intergenic
1050586216 9:7114307-7114329 CCCTGAGGGTGACTAGACTCAGG - Intergenic
1057131525 9:92657526-92657548 CCTTGGGGGAGTCAAGGTTAGGG + Intronic
1058544711 9:106048776-106048798 CCCTAGGGGAGTCTAAGGTCAGG + Intergenic
1061012618 9:127964380-127964402 ACCTGGGGTTGTCAAGGCTCTGG - Intronic
1061673342 9:132201576-132201598 CCCTGGGGGTTCCCAGGCTCTGG + Intronic
1062273064 9:135718529-135718551 CCATGGGGGTGTCTCAGGTCTGG + Intronic
1062390153 9:136330599-136330621 CCCTGGGGGTGTCTGGCTGGGGG + Intronic
1203522231 Un_GL000213v1:54818-54840 GCCTGGGGGTCTCTAAGTGCAGG - Intergenic
1189038009 X:37512640-37512662 CACTGGGGGTGGCTAGGCTCAGG - Intronic
1194670913 X:96731170-96731192 CCATCGGGGTGTATAGGTGCAGG + Intronic
1198249777 X:134868716-134868738 CCCTGGGGGAGCTTACGTTCTGG - Intergenic
1201190415 Y:11438889-11438911 CCCTGGCTCTGTCTAGGTCCTGG + Intergenic