ID: 1022890050

View in Genome Browser
Species Human (GRCh38)
Location 7:34687934-34687956
Sequence ATTTAAAAGCAGAAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022890046_1022890050 -4 Left 1022890046 7:34687915-34687937 CCCCTTAAAGTATTAGCTGATTT 0: 1
1: 0
2: 3
3: 21
4: 284
Right 1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG No data
1022890048_1022890050 -6 Left 1022890048 7:34687917-34687939 CCTTAAAGTATTAGCTGATTTAA 0: 1
1: 0
2: 0
3: 36
4: 505
Right 1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG No data
1022890047_1022890050 -5 Left 1022890047 7:34687916-34687938 CCCTTAAAGTATTAGCTGATTTA 0: 1
1: 0
2: 1
3: 36
4: 321
Right 1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG No data
1022890045_1022890050 3 Left 1022890045 7:34687908-34687930 CCACTATCCCCTTAAAGTATTAG 0: 1
1: 0
2: 0
3: 2
4: 102
Right 1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022890050 Original CRISPR ATTTAAAAGCAGAAACTGGA AGG Intronic
No off target data available for this crispr