ID: 1022890100

View in Genome Browser
Species Human (GRCh38)
Location 7:34688518-34688540
Sequence CCCTTTCCACACAAAGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022890096_1022890100 12 Left 1022890096 7:34688483-34688505 CCCCTTAACAGTGGAGCTTGAGC 0: 1
1: 0
2: 1
3: 8
4: 62
Right 1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG 0: 1
1: 0
2: 1
3: 24
4: 229
1022890097_1022890100 11 Left 1022890097 7:34688484-34688506 CCCTTAACAGTGGAGCTTGAGCA 0: 1
1: 0
2: 1
3: 13
4: 90
Right 1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG 0: 1
1: 0
2: 1
3: 24
4: 229
1022890095_1022890100 13 Left 1022890095 7:34688482-34688504 CCCCCTTAACAGTGGAGCTTGAG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG 0: 1
1: 0
2: 1
3: 24
4: 229
1022890098_1022890100 10 Left 1022890098 7:34688485-34688507 CCTTAACAGTGGAGCTTGAGCAC 0: 1
1: 0
2: 1
3: 4
4: 52
Right 1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG 0: 1
1: 0
2: 1
3: 24
4: 229
1022890094_1022890100 17 Left 1022890094 7:34688478-34688500 CCTGCCCCCTTAACAGTGGAGCT 0: 1
1: 0
2: 0
3: 13
4: 90
Right 1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG 0: 1
1: 0
2: 1
3: 24
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022890100 Original CRISPR CCCTTTCCACACAAAGAACT TGG Intronic
905678686 1:39849924-39849946 CCCTTTCCAAACAGATATCTAGG + Intronic
906426177 1:45714975-45714997 CCCTGTCCTCCCAAAGTACTGGG - Intronic
907835511 1:58104861-58104883 CCCATTCGACACCAAGAAATGGG - Intronic
907876754 1:58496948-58496970 ACCTTTGCAAACAAAGAACCAGG + Intronic
908749192 1:67403401-67403423 CCCTGGCCACCCAAAGAGCTGGG - Intergenic
909565243 1:77046375-77046397 GCTCTTCCACACAAAGAATTTGG - Intronic
910122948 1:83810452-83810474 CCCTTTCCACAGAGAGGTCTAGG - Intergenic
910934372 1:92475616-92475638 CCTCTTCCACACAAATATCTGGG + Exonic
912523805 1:110265997-110266019 CCCTTTTCACATAGAGAGCTAGG + Intronic
913444695 1:118938262-118938284 CCCTTTTCCCAAATAGAACTTGG - Intronic
913544876 1:119858363-119858385 TTCTTCCCAGACAAAGAACTAGG + Intergenic
915834618 1:159166008-159166030 CAGTTTCTACACAAAGCACTCGG + Intergenic
916013510 1:160727818-160727840 CCTTTGCTACCCAAAGAACTTGG + Intergenic
916630181 1:166604156-166604178 CCCTTTCAACTCAAAGATGTGGG + Intergenic
919270689 1:195339933-195339955 CTCTTGCCACACAAAAAAATAGG - Intergenic
920511646 1:206556624-206556646 GCCTTCCCACCCATAGAACTTGG - Intronic
1063374666 10:5546973-5546995 CCCTGCCCACACAAAGTCCTGGG + Intergenic
1065266375 10:23980537-23980559 CCCTTTCCACACAAAACCCGAGG - Intronic
1065783133 10:29189373-29189395 GCCTTTCCCCACCAAGGACTGGG - Intergenic
1067156143 10:43782807-43782829 CCCTTTCCATGAAAAGACCTAGG + Intergenic
1068079730 10:52305560-52305582 CCCCAGCCTCACAAAGAACTGGG - Intergenic
1069203106 10:65647810-65647832 CCTTTTCCTCCCAAAGTACTGGG - Intergenic
1069616217 10:69807823-69807845 CCCTTTCCAGACAATTAACTAGG + Intronic
1072275408 10:93817629-93817651 ACCTCTCCATCCAAAGAACTGGG - Intergenic
1072395329 10:95033517-95033539 CCCTTTCCTTACTAAGATCTTGG - Intergenic
1074690959 10:116003679-116003701 CCCTTTCCACCCAAACAAACAGG - Intergenic
1080831866 11:35902002-35902024 CCCTCTCAACAGAAAGAGCTAGG - Intergenic
1081965128 11:47164812-47164834 CCCTTTCTACAGTAAGCACTTGG - Exonic
1083915729 11:65742459-65742481 CCCTTTCCATGCCAACAACTTGG - Intergenic
1084869565 11:72088785-72088807 CATTTTCCAGACAAAGAAATGGG + Intronic
1086978134 11:93161088-93161110 CCTTTTCCTCCCAAAGCACTGGG + Intronic
1086984126 11:93229979-93230001 CCCTTTCAGCAGAAAGAGCTAGG + Intergenic
1089287838 11:117419225-117419247 CCCTCTTCACACAAAGAAAGAGG - Intergenic
1090653101 11:128824122-128824144 CCCTTTCCACAAAGACCACTTGG - Intergenic
1091653556 12:2327411-2327433 CCCTTTCTACTCAAAGAAAATGG + Intronic
1092123560 12:6060731-6060753 CCCCTCCCACAGAAAGAAGTTGG + Intronic
1093333756 12:17875256-17875278 CCCTTGGGAAACAAAGAACTTGG + Intergenic
1095792496 12:46182547-46182569 CCCTGTCCACAAGAAGAACTTGG + Intergenic
1095858788 12:46891526-46891548 CCCTTTCCACAAATAGAGCTGGG - Intergenic
1095987138 12:48005939-48005961 CCCTTTCCAACCAGAGCACTTGG - Intergenic
1097866420 12:64562876-64562898 CCCTTGCCTCACAAAGTGCTGGG + Intergenic
1099451466 12:82812465-82812487 ACCCTTCCACTCAAAAAACTTGG - Intronic
1099500285 12:83405517-83405539 CCCTTACCCCACAAATATCTAGG + Intergenic
1099638676 12:85253480-85253502 ACCTTTCAACACAAAGAATGTGG + Intronic
1099748725 12:86743230-86743252 GCATTTCTTCACAAAGAACTAGG + Intronic
1099889984 12:88579427-88579449 CCCTTTCTAAACGAAGAACCAGG + Intronic
1099899885 12:88695103-88695125 CCCTTTCCAAATAGAGAAATTGG + Intergenic
1100085269 12:90902712-90902734 CTCTTTCCACACAAAGTAGAGGG + Intergenic
1102792687 12:115660493-115660515 TCCTTTACAAACAAGGAACTGGG - Intergenic
1103852984 12:123945501-123945523 CCCTTTCCACAGCAAGCACGCGG - Intronic
1104118406 12:125773098-125773120 CCCCTTCCAGAGAAAGAATTTGG - Intergenic
1106266739 13:28117431-28117453 CCCTTCTGACACAAAGAACATGG + Intergenic
1106297150 13:28425431-28425453 CCCTTACACCACAAAGAAATTGG + Intronic
1106423571 13:29604483-29604505 CCCTTTCCTAACAAACAACAAGG - Intergenic
1109503973 13:63274501-63274523 CCTTTTCCATACAAGAAACTTGG + Intergenic
1110993096 13:82069176-82069198 CCCTTTCTATGCAAAGATCTTGG - Intergenic
1113502783 13:110790944-110790966 CCCTTTAAAAACAGAGAACTTGG - Intergenic
1113702941 13:112400605-112400627 CCCTCTCCACAGAAAGAGCTAGG + Intronic
1114581584 14:23765265-23765287 CCCTTTCCCCACAAAGGCCGAGG + Intergenic
1114956666 14:27829077-27829099 TCATTTCCACACAAAGAAAATGG - Intergenic
1115415560 14:33128819-33128841 CCCTTTCCAACCAGAGAAGTAGG + Intronic
1115941748 14:38617958-38617980 CCCTTCCCACATGAAGAACTTGG + Intergenic
1116866111 14:50032917-50032939 CCTTGGCCACACAAAGTACTGGG + Intergenic
1116946463 14:50839865-50839887 CTCTTGGCACACAAAGAACCTGG - Intergenic
1117786932 14:59295769-59295791 CCCTTTTCTCACAAAGATATTGG - Intronic
1117800777 14:59442625-59442647 CCATTTCCAAAGACAGAACTGGG + Intronic
1119276299 14:73359782-73359804 CCCTTTACTGACAAATAACTTGG + Intronic
1119630038 14:76222354-76222376 CCCTGGCCTCCCAAAGAACTAGG - Intronic
1121079388 14:91095480-91095502 CCCTTACCAAAGAAAGAACATGG - Intronic
1121106874 14:91286250-91286272 CCGTTCCCACTCAAAGACCTTGG + Intronic
1121226912 14:92327817-92327839 CCCTTTCCACAAAAGGGACAAGG - Intronic
1121388760 14:93556071-93556093 CCATTTCCACACCAAATACTGGG + Intronic
1121866343 14:97366137-97366159 CCCTTCCCAGAGAAATAACTAGG + Intergenic
1123440109 15:20284475-20284497 CCCTTTACACAGAAAGAAATTGG - Intergenic
1123501191 15:20882609-20882631 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123558443 15:21456314-21456336 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123594674 15:21893589-21893611 TCCTTCCCATACAGAGAACTGGG - Intergenic
1124826526 15:33101796-33101818 CCCTATCCAACCAAAGAATTTGG - Intronic
1126691254 15:51290576-51290598 CCCTTTCCATACAAAGTGCCAGG - Intronic
1127235385 15:57045219-57045241 TCCTTTTCACAAAAGGAACTGGG + Intronic
1128719976 15:69941219-69941241 CCCTTGCACCACAAATAACTTGG + Intergenic
1129169816 15:73800806-73800828 CCCTTTACTCAAAAAGAGCTTGG + Intergenic
1129972838 15:79795461-79795483 CACTTTCCTCAAAGAGAACTTGG - Intergenic
1131009263 15:89003819-89003841 CCCTTTCAGCACAGTGAACTGGG + Intergenic
1131532519 15:93205985-93206007 CCCCTTTCCCACAAAGAACATGG + Intergenic
1202966793 15_KI270727v1_random:183464-183486 TCCTTCCCATACAGAGAACTGGG - Intergenic
1133490667 16:6264936-6264958 CGGTTCCCACACACAGAACTCGG - Intronic
1133804015 16:9109234-9109256 CCCTTTCCAGAGATAGCACTGGG - Intronic
1135117030 16:19732574-19732596 CCTTTTCCTCCCAAAGTACTGGG + Intronic
1135764507 16:25165965-25165987 CCAGTTCAAAACAAAGAACTGGG - Intronic
1136368550 16:29821311-29821333 CCCTTGGCACACAGAGCACTGGG + Intronic
1136845064 16:33569960-33569982 CCCTTTACACAGAAAGAAATTGG + Intergenic
1137008126 16:35297352-35297374 CACTTTCCACAAAAGGAATTGGG + Intergenic
1137320417 16:47375177-47375199 CACTTTCCACACACAGAAAATGG - Intronic
1137335813 16:47547450-47547472 CTCTTTCCACACAAAATACAAGG - Exonic
1139342660 16:66278540-66278562 CCCTTCCCATACAGAGAATTGGG + Intergenic
1140294752 16:73697855-73697877 CCGTTTCCACAAACAGAGCTTGG - Intergenic
1140670355 16:77271596-77271618 TCCTTTCCACACAAAAAAAGAGG - Intronic
1140860562 16:79014128-79014150 CCCTTCCCAGAAAAAGATCTTGG - Intronic
1203106772 16_KI270728v1_random:1418613-1418635 CCCTTTACACAGAAAGAAATTGG + Intergenic
1203155232 16_KI270728v1_random:1870258-1870280 CCCTTTACACAGAAAGAAATTGG + Intergenic
1144152793 17:12466620-12466642 CACCTATCACACAAAGAACTAGG - Intergenic
1145203635 17:20968905-20968927 CCCCTTTCACACAGAGAACATGG + Intergenic
1145988467 17:29063374-29063396 CCTTGGCCACACAAAGCACTGGG - Intergenic
1146157106 17:30533921-30533943 CCCTGGCCTCCCAAAGAACTGGG + Intergenic
1148067853 17:44885984-44886006 CCCTGTCCTCCCAAAGAGCTGGG - Intronic
1148106927 17:45123897-45123919 CTCTTTCCAGACAAAGAGCTGGG + Intronic
1148550728 17:48549527-48549549 CCCTCTCCACAGAAAGCAGTTGG - Exonic
1149972679 17:61234838-61234860 ACATTTCCTCACAAAGCACTAGG + Intronic
1151919610 17:77143902-77143924 CCCTTTGAACACACAGAAGTGGG + Intronic
1152575681 17:81139878-81139900 CACTGTCCACACAAGGAACCAGG + Intronic
1152901221 17:82942102-82942124 GCCTTTACACACACAGAAATGGG - Intronic
1153407428 18:4756869-4756891 CCCTTTCCACCTTAAGGACTAGG + Intergenic
1156602771 18:38629950-38629972 TCTTTTCCACACAAAGATATTGG - Intergenic
1156898024 18:42269041-42269063 CCCTTTCCACACACTGTAATTGG - Intergenic
1159444754 18:68528073-68528095 CCCTTTGCACACACAGCCCTGGG - Intergenic
1160493264 18:79355237-79355259 CCCTTGCCATACCAAGAACCAGG + Intronic
1162806036 19:13138553-13138575 CCCTTTCCCCACCGAGAGCTGGG + Exonic
1166581539 19:43904291-43904313 CACTTACCACACCAAGAACTGGG + Intergenic
1166964146 19:46517761-46517783 GCCTTTCCTCCCAAAGAGCTGGG - Intronic
927714677 2:25343629-25343651 CCCTGTCCTCACAGAGCACTGGG - Intergenic
929205334 2:39285140-39285162 CCTTTTCCACTGAAAGCACTGGG + Intronic
931457901 2:62426535-62426557 ACCTTTCCACACACACAGCTGGG + Intergenic
933067017 2:77810126-77810148 CCCTTCCCCCAAAATGAACTAGG - Intergenic
934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935937191 2:108199287-108199309 TCCTTTCCACACACACAAATTGG + Intergenic
937277293 2:120693149-120693171 CCTTCTCCACTCAAAGAACCAGG + Intergenic
937616227 2:123925040-123925062 CCCTTTCGTCACACAGAACATGG - Intergenic
941342864 2:164329153-164329175 CCCTTTCCTTGCAAAGAACTTGG - Intergenic
941457758 2:165730452-165730474 GCCTTTCCTCCCAAAGTACTGGG - Intergenic
943556534 2:189412906-189412928 TACTTTCCACTCAGAGAACTTGG - Intergenic
945546195 2:211155201-211155223 CCCTTGCCACACACTGACCTGGG + Intergenic
946063996 2:216970497-216970519 CCCAGTCAACACACAGAACTGGG - Intergenic
946673747 2:222134696-222134718 CCTTTTCCTCTTAAAGAACTAGG + Intergenic
946832182 2:223738189-223738211 CACCTCACACACAAAGAACTAGG - Intergenic
948892843 2:240915659-240915681 CCCTCTCCACACAACCAAATGGG + Intergenic
1170317324 20:15056559-15056581 CCCCTTCCACTCAAACTACTTGG + Intronic
1170600132 20:17835686-17835708 CCCTTCCCAGACAAAGACCTGGG + Intergenic
1172313551 20:33936084-33936106 CCCTTTCCAAATATTGAACTTGG - Intergenic
1172391524 20:34568457-34568479 GCCTTCCCACACACAGACCTGGG + Intronic
1172406994 20:34697202-34697224 CCCTCTCCACACATAGCATTTGG + Intronic
1173220190 20:41126003-41126025 CCCTTTGCCCACACCGAACTCGG - Intergenic
1173802440 20:45902776-45902798 CCTTTGCCACACAAAGAAACAGG + Intronic
1175313135 20:58025516-58025538 CCCTTCCCACACAAAGGCTTGGG - Intergenic
1175679432 20:60975172-60975194 TCCTTTCCACCCAAGGACCTAGG + Intergenic
1175861078 20:62150794-62150816 CCCTTTCCTCTCAAACATCTTGG - Intronic
1177512027 21:22099844-22099866 CCCTTTTCACACCAAAGACTGGG - Intergenic
1178467932 21:32865627-32865649 CCCTTTACAAACAAAGAAATAGG - Intergenic
1179099146 21:38341531-38341553 CCCTTTCCCCAAAGAGAACAAGG - Intergenic
1179823905 21:43953089-43953111 CCGTTTCCTCACAATTAACTCGG - Intronic
1180055754 21:45358426-45358448 CCCCGTCCACACAGAGAACCTGG + Intergenic
1180912203 22:19458691-19458713 CCTCGGCCACACAAAGAACTGGG + Intronic
1181522801 22:23459194-23459216 CGCTGTCCACACACAGACCTCGG - Intergenic
1182213324 22:28694872-28694894 CCCTTTACACAGAAAGAAATTGG + Intronic
1182722049 22:32411044-32411066 CGGTTTCCACACAAAGAAAGTGG + Intronic
1182787800 22:32922224-32922246 CCCTTGCCACACACAGGCCTTGG + Intronic
1184159605 22:42690269-42690291 CCATTTCCACTCAAATTACTAGG + Intergenic
950785261 3:15428530-15428552 CTCTTTACCCACAAGGAACTTGG - Intronic
951371144 3:21850227-21850249 CCCTTCTGCCACAAAGAACTAGG + Intronic
954792677 3:53144700-53144722 CCCTTTCCCCTCAGAGGACTAGG + Intergenic
954795685 3:53160543-53160565 TCCTTTCCAGACATGGAACTTGG - Intronic
954862050 3:53698768-53698790 CCCTTTACACACGAAAAACTGGG - Intronic
955033723 3:55245764-55245786 CCCATTCCACACTAAAAGCTAGG + Intergenic
956073733 3:65482979-65483001 CCCTTGACAGACAAAGATCTTGG + Intronic
956259475 3:67322844-67322866 CTCTTTCCAGCCAAAGGACTAGG - Intergenic
956445520 3:69322103-69322125 CTCTTTCCACCCAGAGAACAAGG + Intronic
956724553 3:72146277-72146299 CCTTTTACAGATAAAGAACTGGG - Intergenic
964256363 3:154778925-154778947 TGCTTTCCAGACAAAGGACTAGG + Intergenic
964394278 3:156229018-156229040 CCCTTTACACACAAGGAAGAGGG - Intronic
964862744 3:161220432-161220454 TTCTTTCCACACAAAGAAACTGG + Intronic
968184783 3:196625114-196625136 CCTTTGGCACAGAAAGAACTCGG - Intergenic
968281328 3:197479054-197479076 CACTTCCCACACAAAGAGCTCGG - Intergenic
970296873 4:14639941-14639963 CCCTTTCCACAGGCTGAACTTGG + Intergenic
971519217 4:27528515-27528537 CTCTTTCCACACAAAGAGGATGG + Intergenic
971611467 4:28731469-28731491 CCCTTTCTGCGCAAAGATCTTGG - Intergenic
974549925 4:63358436-63358458 CCTTTTCCAGACAAAGTAGTTGG + Intergenic
975553700 4:75639050-75639072 CCCTTTTCTCACCAAGACCTGGG + Intergenic
977503535 4:97873035-97873057 CCCTTTCAGCACACAGAGCTAGG + Intronic
979491271 4:121331013-121331035 CCCTGTCCTCCCAAAGAGCTGGG - Intronic
983803613 4:171966262-171966284 CACTTTCCACATTAAGAACTAGG - Intronic
984421795 4:179532690-179532712 CTCTTTCCACTCTAAGAATTTGG - Intergenic
984748195 4:183244328-183244350 CCCTTCGAACACAAAGAATTAGG + Intronic
986481674 5:8195562-8195584 CCCTTTCCCAATAAAGAATTTGG - Intergenic
990647107 5:57857410-57857432 CTCTTTCCACACAAAGTAGATGG + Intergenic
993020685 5:82586800-82586822 ACCTTTCCCCACAAAGACATTGG - Intergenic
993519983 5:88889102-88889124 TGCTTTCCAAACAAAGAAGTGGG - Intronic
993707474 5:91187408-91187430 CATTTTCCAGACAAAGAAATGGG + Intergenic
995973541 5:118003189-118003211 TCCTTTCCACTCAAAGAAAATGG + Intergenic
996430032 5:123364254-123364276 CCCTTTCCTCAGAAGAAACTGGG - Intronic
998751279 5:145324098-145324120 CCTTTTCTCCACAAAGAATTCGG + Intergenic
1000378297 5:160604925-160604947 CCCTTTACAGAAAAAGCACTGGG - Intronic
1001748256 5:174108589-174108611 CCCTTTTAACACAACGAAGTGGG - Exonic
1007020428 6:38514673-38514695 CCCTTTCCTGACAAAGAAGGAGG + Intronic
1007223383 6:40296152-40296174 CTCTTGCCACACAAAGAAACTGG + Intergenic
1007513152 6:42390291-42390313 CCCTCCACACACACAGAACTTGG - Intronic
1008622375 6:53283288-53283310 CCTTTTCCACATAAAGATTTTGG - Intronic
1008786906 6:55179055-55179077 CCCATTCCACACACCTAACTTGG - Intronic
1009526288 6:64750913-64750935 CCCTTCCCATGCCAAGAACTTGG + Intronic
1009998408 6:70922961-70922983 CCATTTCCACACATATAAATGGG + Intronic
1010704189 6:79088353-79088375 CCTTTTCCATGCACAGAACTAGG + Intergenic
1011327534 6:86166306-86166328 CCCTTTCCACAAACAGTGCTGGG + Intergenic
1015019652 6:128457392-128457414 CTCATTCCACACAGAGAAGTAGG + Intronic
1015289319 6:131520364-131520386 CCCTTCCCTTGCAAAGAACTTGG - Intergenic
1015731345 6:136351475-136351497 TACTTTCCACACAAAGTATTGGG - Intronic
1020957441 7:14759173-14759195 CCTTAGCCACCCAAAGAACTGGG + Intronic
1022480201 7:30738647-30738669 CCCTTTACACAGCAAGAACCTGG + Intronic
1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG + Intronic
1023878049 7:44301385-44301407 CCCTGTCCTCCCAAAGCACTGGG + Intronic
1024511925 7:50211597-50211619 CCCCTTCCACAGACAGAACTTGG + Intergenic
1024727146 7:52211292-52211314 CCTTTTCTAGCCAAAGAACTCGG + Intergenic
1029870688 7:103689227-103689249 TGCTATCCACACAATGAACTAGG + Intronic
1030439716 7:109572899-109572921 CCCTTTCCAGACAAAGCAACTGG + Intergenic
1031148885 7:118029721-118029743 CCCTTTTCACATAAAAAGCTTGG + Intergenic
1032547409 7:132755453-132755475 CCCTTTCTCCACAAGGAACAGGG + Intergenic
1032561408 7:132897513-132897535 CCCTTAGCAGACAAAGAGCTTGG - Intronic
1033761596 7:144442030-144442052 CCCATTCCACCAAAACAACTGGG - Intergenic
1034624101 7:152479229-152479251 CCCTGTCCTCCCAAAGTACTAGG + Intergenic
1034979839 7:155468457-155468479 CCCCTTCCAGACAAAGGACTTGG - Intergenic
1034981538 7:155481402-155481424 CCTTGTCCACATATAGAACTTGG + Intronic
1035897811 8:3423702-3423724 ACATTTCCACACAAAGACCTGGG - Intronic
1039447419 8:37643863-37643885 CCCCTTCCATGCAAGGAACTGGG - Intergenic
1040279625 8:46032475-46032497 CCTCTTCCTCCCAAAGAACTGGG - Intergenic
1041739781 8:61145888-61145910 CCGTTTCCTCACCCAGAACTGGG - Intronic
1043168157 8:76930659-76930681 CCCTCTCCCCCCAAAGCACTGGG + Intergenic
1044708041 8:95027162-95027184 CCCATTCCACACAAATAACATGG - Intronic
1045900293 8:107270565-107270587 CCCTTTCCACTGAAAGAACTGGG + Intronic
1048174878 8:132142624-132142646 CCCTTACCCCACACAGAGCTTGG + Intronic
1048194166 8:132318496-132318518 CCCTTTGCAAACACAGAGCTGGG - Intronic
1048820821 8:138379174-138379196 GCCTCTCCAAAAAAAGAACTTGG - Intronic
1049696567 8:143986813-143986835 CCCTCTGCACACAAAGTGCTGGG + Intronic
1049725365 8:144143252-144143274 CCCCTTGAACACAAAGTACTTGG - Intergenic
1050101016 9:2119810-2119832 CTGTTTCCACACAAAGATGTGGG - Intronic
1051137217 9:13935675-13935697 CCCTTTCAACATTAAGCACTTGG + Intergenic
1053677217 9:40445034-40445056 TCGTTTCCACACAAAGAAGATGG - Intergenic
1053926972 9:43071188-43071210 TCATTTCCACACAAAGAAGATGG - Intergenic
1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG + Intergenic
1054290290 9:63280561-63280583 TCGTTTCCACACAAAGAAGATGG - Intergenic
1054388314 9:64585098-64585120 TCATTTCCACACAAAGAAGATGG - Intergenic
1054507405 9:65931261-65931283 TCGTTTCCACACAAAGAAGATGG + Intergenic
1056614963 9:88157301-88157323 CCCTTGCCTCCCAAAGAGCTGGG + Intergenic
1057830752 9:98404721-98404743 CCCTCATCACACAAAGAAATTGG + Intronic
1058230725 9:102420731-102420753 CTCTTTCCAGGCAAAGGACTAGG + Intergenic
1060178100 9:121512434-121512456 CCCTCTCCACAGACAGAGCTAGG + Intergenic
1061100377 9:128487462-128487484 CCCACACCACACAAAGACCTGGG + Intronic
1061288689 9:129638825-129638847 CCCTTTCCACCCAGAGAAGTGGG + Intronic
1186790247 X:12990354-12990376 CCTTTTCCTCCCAAAGCACTGGG - Intergenic
1189206030 X:39239591-39239613 CACTTTCCACATAAGGAAATTGG + Intergenic
1192362923 X:70450458-70450480 CCCTGGCCACAGAAAGAATTAGG - Intronic
1193492258 X:82164432-82164454 CCCTTTGCACAGAAAGACATGGG + Intergenic
1196122238 X:112063624-112063646 CCCTTTCCTCACAGGGGACTGGG + Intronic
1198958333 X:142156566-142156588 CCTCTTCCACCCCAAGAACTTGG - Intergenic
1199256903 X:145727741-145727763 CCCCTCCCACTCACAGAACTAGG + Intergenic
1200063338 X:153493509-153493531 CCCTTTCCAGACAAAGGAGATGG - Intronic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic