ID: 1022891626

View in Genome Browser
Species Human (GRCh38)
Location 7:34706906-34706928
Sequence TGGCATTGTGCAGCTAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022891626_1022891628 6 Left 1022891626 7:34706906-34706928 CCTACACTAGCTGCACAATGCCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1022891628 7:34706935-34706957 TTTCCTCCACCAAGAAGAGCTGG 0: 1
1: 0
2: 2
3: 25
4: 196
1022891626_1022891631 10 Left 1022891626 7:34706906-34706928 CCTACACTAGCTGCACAATGCCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1022891631 7:34706939-34706961 CTCCACCAAGAAGAGCTGGGTGG No data
1022891626_1022891629 7 Left 1022891626 7:34706906-34706928 CCTACACTAGCTGCACAATGCCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1022891629 7:34706936-34706958 TTCCTCCACCAAGAAGAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 187
1022891626_1022891632 11 Left 1022891626 7:34706906-34706928 CCTACACTAGCTGCACAATGCCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1022891632 7:34706940-34706962 TCCACCAAGAAGAGCTGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022891626 Original CRISPR TGGCATTGTGCAGCTAGTGT AGG (reversed) Intronic
901062862 1:6481146-6481168 TGTCCATGTGCAGCTAGAGTGGG + Intronic
901326996 1:8372820-8372842 TGGCCTTGTGCCACTAGTGAGGG + Intronic
904541467 1:31236661-31236683 TGGCTTTGGGCAGCTTGTGAAGG - Intronic
906293611 1:44635712-44635734 GGGCAGTCAGCAGCTAGTGTCGG - Intronic
913465628 1:119140106-119140128 AGGCATTGGGCAGCTTGGGTCGG - Intronic
916810434 1:168300967-168300989 TGGGATTCTGAAGGTAGTGTTGG + Intronic
917967204 1:180186359-180186381 TGGCAGTGTGGGGCTGGTGTGGG - Intronic
1063495358 10:6502444-6502466 TGGCAATGCCCAGCTAGTGCTGG - Intronic
1066000879 10:31103225-31103247 TGACAGAGTGCAGCTAGTGCAGG + Intergenic
1075356188 10:121778981-121779003 TGGTATTGGGAAGCTAATGTAGG - Intronic
1089037399 11:115408974-115408996 TGACACTGTGCAACTAGAGTTGG - Intronic
1091311769 11:134579923-134579945 TGGCATTGAGCTGCCACTGTGGG - Intergenic
1093857939 12:24128138-24128160 TAGCAGTGTGCTGCTATTGTGGG + Intergenic
1095954770 12:47799714-47799736 TGGCAGGGTGCTCCTAGTGTGGG - Intronic
1096558961 12:52422445-52422467 TGGTCTTGTGCAGCCAGTTTGGG + Intergenic
1097501615 12:60410577-60410599 TGGCATTGTGCCCCTGCTGTAGG - Intergenic
1102135045 12:110567220-110567242 TCTCATTGTGCAGCAAGGGTGGG - Intronic
1104016956 12:124967931-124967953 TGGCAGTGTGCGACCAGTGTGGG + Intronic
1104403950 12:128502108-128502130 TTGCAATGTGCAGCCAGGGTTGG + Intronic
1108036263 13:46293409-46293431 TGGAATTGTGTGGTTAGTGTGGG - Intergenic
1108589375 13:51898670-51898692 TGGCTTTGTGCAGCCAGGATAGG - Intergenic
1110443187 13:75548235-75548257 TGGCAGTGTCCAGCTCGTGATGG - Intronic
1111016228 13:82385812-82385834 TGGCAATGTGTAGCTGGTATTGG - Intergenic
1116373481 14:44167076-44167098 AGTAATTGTGCATCTAGTGTGGG - Intergenic
1117494824 14:56292598-56292620 TCACATTGTGGAGCTAGTGCTGG + Intronic
1126931645 15:53659349-53659371 TGGCTTTGTGCAGCACGTGCCGG - Intronic
1132180013 15:99745200-99745222 TGGCACTGAGCAGCTAGCTTTGG + Intergenic
1132384963 15:101393709-101393731 TGGAATAGAGCAGCTTGTGTTGG - Intronic
1132988549 16:2780731-2780753 TGGCGCTGGGCAGATAGTGTTGG + Intergenic
1135490694 16:22906728-22906750 TGGCCTTGGGCAGCTAGTACTGG - Intronic
1138040874 16:53665255-53665277 TGGCAGTATGCAGCTTTTGTGGG + Intronic
1148342494 17:46881656-46881678 TGGCATTGAGCAGCTGGAGGTGG - Intronic
1148395129 17:47302066-47302088 GGGCACAGTGCAGCTAGTGGAGG + Intronic
1149578264 17:57728995-57729017 TCGCAATGTGCAGCCAGGGTGGG - Intergenic
1151948099 17:77330275-77330297 TCACATTGTGGAGCTGGTGTAGG + Intronic
1153553063 18:6282741-6282763 TGGCATTGTGCACCTGGATTAGG + Intronic
1156372144 18:36481082-36481104 AGGCATTCTCCAGCTGGTGTTGG + Intronic
1157058655 18:44260309-44260331 TGGCATTGTACAGCCTGTTTTGG - Intergenic
1157399609 18:47376574-47376596 TGGTATTGTGCAGCCAGGGTTGG - Intergenic
1157674838 18:49561420-49561442 TGGAGTTTTGCAGCTAGTGGCGG + Intronic
1159170029 18:64754298-64754320 TGCCATTGTGAAGCTGGTCTGGG - Intergenic
1160486331 18:79296458-79296480 TTGCAAAGTGCAGCTAGCGTAGG - Intronic
1160985345 19:1836043-1836065 TGGCCTTGGGCAGATAGTGCTGG - Intronic
1165751983 19:38265585-38265607 TGGCGTTGAGCAGCTGGTGTTGG + Intronic
925841930 2:8000319-8000341 TGGCATTGTTCAGTGAGTGTGGG - Intergenic
926964550 2:18395929-18395951 AGGCTTTGTGCAGCTGGTGCAGG + Intergenic
927697428 2:25247713-25247735 TGGCATTGGGGAGCTGGTGTGGG - Exonic
929533971 2:42769007-42769029 TTGCATTTTAAAGCTAGTGTAGG - Intronic
929873148 2:45774769-45774791 TGGGAATGTGCAGCTTGGGTGGG - Intronic
931731357 2:65156152-65156174 TGGCATTGTTCTGCAAGTGTGGG + Intergenic
933309897 2:80647575-80647597 TGGCACTGTCCAGCTAGAGTAGG - Exonic
935334250 2:102000567-102000589 TGGCAGTGTGCATCTCGTGATGG + Intronic
940094296 2:149956660-149956682 TGTCATTGTGATGCTACTGTGGG - Intergenic
945854533 2:215052925-215052947 TGGATCTGTGGAGCTAGTGTAGG - Intronic
946162204 2:217842061-217842083 TGGCATGGAGCAGCTTGTGAAGG - Intronic
946226155 2:218265150-218265172 GGGCATCGTGCAGCTGCTGTGGG - Exonic
946520989 2:220464575-220464597 TGCCATTGTCCAGCTTGTGACGG + Intergenic
1171157468 20:22889619-22889641 TGGCATTGAGCTGCCTGTGTAGG - Intergenic
1172100243 20:32480905-32480927 TGGAATTGTGCAGGGAGTGCTGG - Intronic
1174320306 20:49736470-49736492 TGGCAAGGAGCAGCTAGTGTTGG - Intergenic
1177591369 21:23172466-23172488 TGACATTGTTCAGATATTGTGGG - Intergenic
1179410459 21:41159193-41159215 TGAATTTGGGCAGCTAGTGTGGG + Intergenic
956857778 3:73292866-73292888 TGGCATTGACCAGGCAGTGTTGG - Intergenic
957312046 3:78533099-78533121 TGGCATTTTTCAGTTAGTCTTGG - Intergenic
959368251 3:105490825-105490847 TGGCATTGAGCAGCTTTTCTCGG + Intronic
961423514 3:126827203-126827225 GGGCATTGTGCAACTATTGAAGG + Intronic
961678586 3:128583660-128583682 TGGCAAGGTGCAGCTAGGGTAGG - Intergenic
962709421 3:138072995-138073017 TGGCTTGCTGCAGCTACTGTTGG - Intronic
963928343 3:150975754-150975776 TTGCATTGTGCAGCCAAGGTTGG + Intergenic
966493341 3:180552639-180552661 AGGCATAGTGCTGATAGTGTGGG + Intergenic
975947449 4:79724611-79724633 TTGCATAGTGTAGCTAGAGTAGG + Intergenic
978344793 4:107755910-107755932 TGGCATTGTGCCGCTGCTCTAGG + Intergenic
981578695 4:146230625-146230647 TGTCAATGTGCAGTTAGTGGAGG + Intergenic
983872916 4:172842890-172842912 TGGCATTGTGCACTGTGTGTTGG - Intronic
986256527 5:6105514-6105536 TGTCATTGTGGAGACAGTGTTGG - Intergenic
991226382 5:64277872-64277894 AGGCATTCTTCAGCTAGAGTTGG - Intronic
991640259 5:68744980-68745002 TGGCATTGTGCATGTGGGGTAGG - Intergenic
995941469 5:117590413-117590435 TTGCATTGTGCAGCTGGGGTTGG - Intergenic
996034134 5:118739282-118739304 AGGCATTCTGCAGCTCGTGGTGG - Intergenic
997380428 5:133432352-133432374 TGGCATTGGGTAGATATTGTGGG - Intronic
1010074428 6:71784102-71784124 TGGCATTGTGCCCCTGCTGTAGG - Intergenic
1012210139 6:96509338-96509360 TGGCATTGTGCCCCTGCTGTAGG + Intergenic
1012356465 6:98320309-98320331 TAGCATTGTGCAGGCAATGTAGG - Intergenic
1014662446 6:124190039-124190061 TGGCCATGTGCAGGTAGTTTTGG - Intronic
1016756455 6:147693087-147693109 AGGCCTTGTGTAGCTATTGTCGG - Intronic
1018790135 6:167141983-167142005 TGGCCCTGTGCAGCAAGTCTAGG + Intergenic
1019166683 6:170101867-170101889 TGGCATGGTGCATCTGGAGTCGG + Intergenic
1022891626 7:34706906-34706928 TGGCATTGTGCAGCTAGTGTAGG - Intronic
1025868206 7:65405784-65405806 TGACCTTGTGCAGCTTGTGGTGG + Intergenic
1026220696 7:68393883-68393905 TGGGATTCTACAGCTAATGTGGG - Intergenic
1027153593 7:75750624-75750646 TGGCATTATTTTGCTAGTGTAGG - Intergenic
1028126297 7:87116674-87116696 TAGAACTGTGCAGCAAGTGTGGG + Intergenic
1028298819 7:89170796-89170818 TGGCAGTGTGCTGCTGGTGGTGG - Intronic
1028440822 7:90858565-90858587 TGGCTTTGTGAAGCAAGTTTTGG - Intronic
1028860220 7:95640917-95640939 TGGCATTTTGCAGGGTGTGTGGG - Intergenic
1031611078 7:123828021-123828043 TCACATTGTGCAGCTAGGATGGG - Intergenic
1031618324 7:123906293-123906315 TGGCATTGTGCCCCTGCTGTAGG - Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1038402786 8:27298201-27298223 TGCCATAGTGCAGATGGTGTTGG + Intronic
1044504749 8:93004777-93004799 TGGCATTGTGCCCCTGCTGTAGG - Intronic
1045550524 8:103167666-103167688 TGGCATTTTCCAGCTATTGGAGG + Intronic
1046683538 8:117198678-117198700 TGGCTTTGTACAGCTGGTGGAGG - Intergenic
1047928130 8:129701038-129701060 GGCCATTTTGCAGCTAGAGTCGG - Intergenic
1049855845 8:144861428-144861450 TGGAATTGTGTATCCAGTGTGGG + Intergenic
1050105252 9:2158629-2158651 TAGCATTGTGTAGCAAGTTTTGG + Intronic
1053619575 9:39801809-39801831 TGGCATTGTGCTCCTACTCTAGG + Intergenic
1053877746 9:42561125-42561147 TGGCATTGTGCTCCTACTCTAGG + Intergenic
1053894911 9:42733241-42733263 TGGCATTGTGCTCCTACTCTAGG - Intergenic
1054233948 9:62540569-62540591 TGGCATTGTGCTCCTACTCTAGG - Intergenic
1054264583 9:62905634-62905656 TGGCATTGTGCTCCTACTCTAGG - Intergenic
1057967790 9:99520985-99521007 TAAAATTGTGCAGCCAGTGTGGG + Intergenic
1062075124 9:134583929-134583951 TGGCATTCTCTAGATAGTGTGGG - Intergenic
1187073789 X:15914393-15914415 TGGCAATGTGCAGCTCATGCAGG + Intergenic
1190123920 X:47686755-47686777 TGGCATTGGGGAGCCTGTGTTGG + Intergenic
1191224688 X:58030993-58031015 TGGAATTGTTCAGCTGGTGGTGG + Intergenic
1195408467 X:104543158-104543180 TGCTAATGTGCAGCCAGTGTTGG + Intergenic
1197047719 X:122019607-122019629 TGCAATTGTGCAGCTACTGTGGG - Intergenic
1199399209 X:147376990-147377012 TGGCAATGTGCAGCAGATGTGGG + Intergenic
1201562587 Y:15333626-15333648 TGGCATCTGGCAGCTAATGTGGG + Intergenic