ID: 1022892967

View in Genome Browser
Species Human (GRCh38)
Location 7:34719945-34719967
Sequence AAGTGTGGCATGGGCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022892967_1022892974 11 Left 1022892967 7:34719945-34719967 CCCTCCATGCCCATGCCACACTT 0: 1
1: 0
2: 3
3: 26
4: 287
Right 1022892974 7:34719979-34720001 GAAAAAAAAAAAAGGAGCCAAGG 0: 1
1: 10
2: 121
3: 1729
4: 11185
1022892967_1022892976 21 Left 1022892967 7:34719945-34719967 CCCTCCATGCCCATGCCACACTT 0: 1
1: 0
2: 3
3: 26
4: 287
Right 1022892976 7:34719989-34720011 AAAGGAGCCAAGGCCAGGCATGG No data
1022892967_1022892975 16 Left 1022892967 7:34719945-34719967 CCCTCCATGCCCATGCCACACTT 0: 1
1: 0
2: 3
3: 26
4: 287
Right 1022892975 7:34719984-34720006 AAAAAAAAGGAGCCAAGGCCAGG 0: 1
1: 0
2: 15
3: 242
4: 2065
1022892967_1022892973 3 Left 1022892967 7:34719945-34719967 CCCTCCATGCCCATGCCACACTT 0: 1
1: 0
2: 3
3: 26
4: 287
Right 1022892973 7:34719971-34719993 TTCAAAAAGAAAAAAAAAAAAGG 0: 2
1: 179
2: 3963
3: 10672
4: 52681
1022892967_1022892977 24 Left 1022892967 7:34719945-34719967 CCCTCCATGCCCATGCCACACTT 0: 1
1: 0
2: 3
3: 26
4: 287
Right 1022892977 7:34719992-34720014 GGAGCCAAGGCCAGGCATGGTGG 0: 1
1: 3
2: 82
3: 634
4: 3510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022892967 Original CRISPR AAGTGTGGCATGGGCATGGA GGG (reversed) Intronic
901204972 1:7489423-7489445 ATGTGTGCCATTGGCATGCAGGG + Intronic
902380436 1:16050020-16050042 ATGTGGGGCATGGGCTAGGATGG - Intronic
904929455 1:34074824-34074846 AAGGGTGTCCTGGGCAAGGAAGG + Intronic
905022552 1:34827872-34827894 ATGTCTGCCATGGTCATGGAAGG - Intronic
905160256 1:36027024-36027046 AAGTTTGGGAAGGGAATGGAAGG - Intronic
905910553 1:41650350-41650372 AACACTGGCATGGGCATGGCGGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907351197 1:53832769-53832791 CAGTGTGGGCTGGGCATGGGGGG + Intronic
907474806 1:54698575-54698597 ATGTCAGGCAAGGGCATGGAGGG + Intronic
908944978 1:69484709-69484731 AAGTGTCGCATAGGCACAGATGG + Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
916574301 1:166053441-166053463 AAGTGTCGCATTGGCCTGCAAGG - Intergenic
916579006 1:166091116-166091138 AGGTGTGGCACGGGCAGGAAGGG + Intronic
916666133 1:166969207-166969229 TGGTGAGGCAAGGGCATGGAAGG + Intronic
917121087 1:171645350-171645372 ACGTGTGGCAAGGGCATGGTGGG - Intronic
917843746 1:179003293-179003315 AGGTATGGAATGTGCATGGAGGG + Intergenic
919056295 1:192573590-192573612 AAGTGTGACAAGTGCATGGCAGG - Intergenic
920574255 1:207045748-207045770 AAGTTAGGCATGGGCATTTAGGG + Exonic
922167172 1:223125812-223125834 GAGTGTGGCTTGGGCATCCAGGG + Intronic
922315193 1:224435126-224435148 CAGTGTGGCATGGGCATGTAAGG + Intronic
923167059 1:231375689-231375711 GAGTGTGGCATGGGCTTAGTGGG + Intronic
924195521 1:241603118-241603140 AAGTGTCTCTGGGGCATGGAAGG + Intronic
1062797865 10:358174-358196 AAGTCAGGCGTGGGCTTGGAGGG - Intronic
1063489327 10:6448383-6448405 CAGTGTGGCCTGGCCAGGGAAGG + Intronic
1063848739 10:10161157-10161179 AGGTGGGGCTTGGGCATGGCGGG - Intergenic
1064130940 10:12709015-12709037 AACTGTGGCATGGGAGTGGGGGG + Intronic
1064194062 10:13231298-13231320 AGGTGGGGCATGGGTATGGATGG - Intronic
1067379078 10:45755868-45755890 AAGGATGGCATAGGAATGGATGG + Intronic
1067691303 10:48504038-48504060 AAGTGCGGGATGGGGAAGGAGGG + Intronic
1067886781 10:50096531-50096553 AAGGATGGCATAGGAATGGATGG + Intronic
1068776679 10:60874985-60875007 ACGAGTGGCGTGGGCATTGACGG - Exonic
1069622869 10:69848659-69848681 AAGTGTGGCGTGGGGAAGGCAGG - Intronic
1070523614 10:77276015-77276037 AGGTGGGGCAAGGGCAAGGAAGG - Intronic
1071537555 10:86447756-86447778 AAGTATGGCCTGGCCATGCAGGG + Intronic
1074715101 10:116211167-116211189 AGGTGTGGCAAGGCCATGGCTGG - Intronic
1074889075 10:117720354-117720376 AGGTCTGGCATGGGCATGCCAGG + Intergenic
1074947082 10:118290723-118290745 CAGTGTGGTATGGCCATAGATGG + Intergenic
1075433171 10:122407276-122407298 AATTGTAGCATGGGAAAGGAGGG - Intronic
1076213928 10:128677430-128677452 GAGTGTGGCATGGACATACATGG - Intergenic
1076562158 10:131374034-131374056 CAGTGGGGCCTGGGCAGGGAGGG - Intergenic
1077196460 11:1283314-1283336 AAGGGAGGCAAGGCCATGGAGGG + Intronic
1077462057 11:2715607-2715629 AAGGCTGGCAGGGGCTTGGAAGG - Intronic
1077500794 11:2909076-2909098 GAGTGCGGGATGGGGATGGAGGG - Intronic
1077590355 11:3486188-3486210 AACTGTGGCAATGGCATGGGGGG + Intergenic
1078180486 11:9006121-9006143 AAGTGTGCCAGGGGACTGGAAGG - Intergenic
1078682350 11:13488685-13488707 AAGTGGGGCATGGGGATGTTGGG - Intergenic
1078913736 11:15758192-15758214 ATGTTTTACATGGGCATGGAAGG + Intergenic
1079105942 11:17572485-17572507 AAGGGGGGCATGGGCAGAGAGGG - Intronic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1079924890 11:26481654-26481676 AAGTATTGCATGGAGATGGAAGG + Intronic
1080410040 11:32014608-32014630 AAGGGTGGGATGGGCAGGGTTGG + Intronic
1080782150 11:35439555-35439577 AAGTGGGGAAGGGGAATGGAAGG + Intronic
1081693555 11:45094418-45094440 GAGTGGGGCATGGGCTGGGAGGG + Intergenic
1081860049 11:46327866-46327888 AGGGTTGGCATGGGCGTGGAAGG + Intergenic
1082685350 11:56231713-56231735 GAGGGTGGCATGGTCAGGGAGGG - Intergenic
1083730947 11:64652242-64652264 ATGTGTGGCATGTGCGGGGATGG - Intronic
1085369654 11:75988904-75988926 AAGTGGGGAAGGGGGATGGATGG + Intronic
1086180683 11:83947692-83947714 ACCCGTGGCATAGGCATGGATGG + Intronic
1087652843 11:100888389-100888411 AAGTGTTGCATGGGGAAGAATGG + Intronic
1088304655 11:108395198-108395220 CCATGTGGGATGGGCATGGATGG + Intronic
1088505315 11:110521792-110521814 AAGTGTGGACAGGGCCTGGATGG + Intergenic
1088626732 11:111735093-111735115 AAGAGTAGAAGGGGCATGGAAGG + Intronic
1093778019 12:23099906-23099928 CAGTGTGGTATGGGAATGGAGGG + Intergenic
1095875679 12:47078368-47078390 ATGTGGTGCATTGGCATGGAAGG + Exonic
1096010801 12:48212742-48212764 AAGTGAGGAATGGGGAAGGAGGG + Intergenic
1096096243 12:48937597-48937619 GAGGATGGCAGGGGCATGGAGGG + Exonic
1100511826 12:95282748-95282770 AACTGAGGCATGAGCATGAAGGG + Intronic
1100793735 12:98158149-98158171 AAGAGTGGCATGACCAAGGAGGG + Intergenic
1101333787 12:103778561-103778583 CAGTCTGGCCTGGGCATGGCAGG + Intronic
1101604034 12:106234327-106234349 AAGTAAGGCATGGGCATTGCTGG + Intergenic
1102560579 12:113759327-113759349 ATGTCTGCCATGGGCAGGGATGG - Intergenic
1103586908 12:121962925-121962947 CAGAGTGGAATGGGCAAGGAGGG + Intronic
1104849922 12:131867963-131867985 AGGTGTGTGGTGGGCATGGAAGG + Intergenic
1106017248 13:25881430-25881452 AAGTGTGGAATGGGAATGCTGGG - Intronic
1108088032 13:46816585-46816607 AAGAGTGGCATGGGTGAGGAGGG - Intergenic
1108640812 13:52380834-52380856 AAGGATGGCATGGGCATCAAAGG - Intronic
1110620235 13:77586482-77586504 GAGTTTGAGATGGGCATGGAGGG - Intronic
1111991144 13:95118659-95118681 AGGTGTGGCATGTGCATGGAGGG - Intronic
1112977333 13:105336664-105336686 GAATGTGGCAGGGGCATGGCAGG + Intergenic
1113120481 13:106919049-106919071 AACTGTGGCATGGAAATGGATGG + Intergenic
1113651493 13:112036784-112036806 AAGGATGGCAGGGGCCTGGAGGG + Intergenic
1113933929 13:113983221-113983243 AATGGTGGCATGAGCATGGGTGG + Intronic
1113934281 13:113985219-113985241 AATGGTGGCATGAGCATGGGTGG + Intronic
1113934625 13:113987209-113987231 AATGGTGGCATGAGCATGGGTGG + Intronic
1114413581 14:22523434-22523456 AAGTGAGGAATGAGCAGGGAAGG - Intergenic
1119185947 14:72642691-72642713 GAGTGAGACAGGGGCATGGAGGG - Intronic
1120939500 14:89933777-89933799 AACTGTGGCATGGGCAATGAGGG + Intronic
1121049734 14:90812566-90812588 AAGTGTGGCCTGGGGATGAGTGG - Intronic
1122238996 14:100349502-100349524 CTGTGTGGCCTGGGCATGGGAGG - Intronic
1124021172 15:25925345-25925367 GAGAGTGGCATGCCCATGGAGGG + Intergenic
1124146240 15:27127992-27128014 AAATGTGACCTGGGTATGGAAGG + Intronic
1125454265 15:39841607-39841629 AAGTGAGGAATGGGCAAGGAAGG + Intronic
1128980424 15:72181353-72181375 AAGTGGGGCAGGGGAGTGGAGGG + Intronic
1129750132 15:78056886-78056908 ACCTGTGGCATGGGGATGGAGGG - Intronic
1130257424 15:82332251-82332273 AAGTGAGGTCTGGGCATGAAGGG + Intergenic
1130298105 15:82661356-82661378 AAGAGTGGCTTGGGCAAGGGAGG - Intronic
1130597521 15:85257714-85257736 AAGTGAGGTCTGGGCATGAAGGG - Intergenic
1132581666 16:687541-687563 AGGTGTGGCATGGGGGTGCAGGG - Exonic
1132630549 16:915235-915257 GTGTGAGGCATGGGTATGGATGG + Intronic
1133019169 16:2959288-2959310 AAGAGTGGGATGGGCAAGGGAGG + Intergenic
1133732715 16:8590288-8590310 GAGTGAGGCAGGGGAATGGAGGG - Intergenic
1134237506 16:12478813-12478835 AAGGGAGGCCTGGGCATGGAGGG + Intronic
1134291746 16:12907161-12907183 AAGGGTGGAAGGGGGATGGAGGG - Intronic
1140769821 16:78193224-78193246 AAGTGAGGCAAAGGCAGGGAGGG + Intronic
1141166724 16:81665779-81665801 ATGTCTGCCATGAGCATGGAAGG - Intronic
1141986778 16:87585395-87585417 AAGGGTGGGGTGGGCAGGGATGG + Intergenic
1142715516 17:1745104-1745126 AAGAGGGGCGTTGGCATGGAGGG + Intronic
1144631627 17:16875877-16875899 AAAAGTGGCATGGGCTTGCATGG - Intergenic
1144800005 17:17919635-17919657 AAGTGGGGCATGGGGGAGGAGGG + Intronic
1146055723 17:29580058-29580080 AAGAGAGGCAGAGGCATGGAGGG - Intronic
1146306474 17:31733469-31733491 AAGTGTGGCCTGGTCCTGGCAGG - Intergenic
1147155209 17:38541352-38541374 AAGTGAGACAGGGGCACGGAGGG + Intronic
1151787087 17:76280266-76280288 AGGTGAGGCAGGGGCATGGCGGG - Exonic
1152252701 17:79220055-79220077 AAGGGTGGCATGGCCTGGGAAGG + Intronic
1152643631 17:81459167-81459189 ATGTGAGGCCTGGGCATGGTGGG + Exonic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1155198977 18:23501238-23501260 ATGTGTGACATGGGCCTGGGTGG + Intergenic
1155499350 18:26471536-26471558 AAGTGTCACATGGTCAGGGATGG + Intronic
1155551667 18:26972021-26972043 AGGTGTGGCAGGGGTGTGGAGGG + Intronic
1156234218 18:35185409-35185431 AAGTGGGGCATGGGGTAGGAAGG + Intergenic
1156401759 18:36745760-36745782 ATGAGTGGCAGGTGCATGGAGGG - Intronic
1156715789 18:40008370-40008392 AAGTGTGGCATGGCTATTGTTGG + Intergenic
1157105816 18:44773298-44773320 AACTGAGGGATGGCCATGGAGGG + Intronic
1157544321 18:48537410-48537432 GAGAGTGGCATGGGCCTTGAAGG - Intergenic
1159541187 18:69778914-69778936 ATGAGTGGAATGGGGATGGAAGG + Intronic
1160842299 19:1151500-1151522 AGGGGTGCCATGGGCATGGCAGG + Intronic
1161333144 19:3697699-3697721 GAGTGGGGCAGGGGCAGGGATGG + Intronic
1161768179 19:6218050-6218072 AATGGTGGGATGGGCAGGGAGGG + Intronic
1163497486 19:17655238-17655260 AAGTGTGGCAGGGGCATGGCTGG + Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1164503727 19:28841028-28841050 ATGCGTGGCATGGGCCTGGGAGG - Intergenic
1166166320 19:40991573-40991595 AGGGGTGGCACGGGCATGGTTGG + Intronic
1166886947 19:45967450-45967472 AAGAGTGGGATGGGAATGGGTGG - Intronic
925105736 2:1289474-1289496 AAGTGTGCCATGGGCTTCCAGGG - Intronic
925617385 2:5756536-5756558 CAGTGTGGGAAAGGCATGGAAGG + Intergenic
926389198 2:12370139-12370161 TGGGGTGGCAGGGGCATGGAGGG + Intergenic
927855892 2:26527807-26527829 AAGTGTGGGATGGGGCAGGAGGG - Intronic
929922648 2:46183609-46183631 GAGTGCGGCATGGGGATGGCGGG - Intronic
929948930 2:46391381-46391403 AAAGGTGGGATGGGCACGGATGG + Intergenic
930608563 2:53517185-53517207 ATGTGTGGCATGGACACAGAAGG - Intergenic
931206803 2:60154934-60154956 AAGTCTGCCATGGGGAAGGAGGG + Intergenic
932861061 2:75291669-75291691 AAGTCTGGCACGGGGAGGGAGGG - Intergenic
934874973 2:97909242-97909264 CAGTGTGGCAGTGGGATGGATGG + Intronic
936032141 2:109081019-109081041 AAGTGCTGCATGGCCATGCATGG - Intergenic
937064691 2:119009058-119009080 TGGTGTGGCTTGGGCATGGAAGG - Intergenic
937251722 2:120528134-120528156 CACTGTGGCAAGGGCTTGGAAGG + Intergenic
937399051 2:121565588-121565610 AAGGGAGGGATGAGCATGGAAGG - Intronic
937621885 2:123997958-123997980 AAGTGGTGTAAGGGCATGGAAGG - Intergenic
937883810 2:126886784-126886806 AGGTGTGGCGTGGGGAGGGAGGG - Intergenic
939877711 2:147596756-147596778 TAGAGTAGCATGGGCAGGGAAGG + Intergenic
940259565 2:151765944-151765966 GAGTGTGGCCTGAGCACGGAGGG - Intergenic
941399267 2:165010769-165010791 AAGCGAGGGATGGGGATGGATGG + Intergenic
941790474 2:169547252-169547274 GAGGGTGGCATGGTCAGGGAGGG - Intronic
942240446 2:173959662-173959684 AAGAATGGCTTGGGCCTGGAAGG + Intronic
942921774 2:181382954-181382976 AACTGCAGCATGGGTATGGAGGG + Intergenic
943763521 2:191635531-191635553 AAGGCTGGCCTGGGGATGGAGGG + Intergenic
945694575 2:213086775-213086797 TAGTGTGGAATGGGAGTGGAGGG + Intronic
948865411 2:240772486-240772508 TAGGGTGGCATGGTCAGGGAGGG - Intronic
1169318735 20:4613669-4613691 AACTCTGGCATGGGGAGGGATGG + Intergenic
1170909244 20:20547598-20547620 AGATGTGGCCTGGCCATGGATGG - Intronic
1170946642 20:20896702-20896724 AGGAGTGGAAAGGGCATGGAGGG + Intergenic
1170996257 20:21362662-21362684 AAGTGGGTTATGGTCATGGAGGG - Intronic
1171981374 20:31631683-31631705 CAGTGTGGCTGGGGCATGGTGGG + Intergenic
1172061128 20:32188246-32188268 GAGTGAGGCAGGGGCAAGGATGG - Intergenic
1172437600 20:34940957-34940979 AAGGGAGGCATGGGCATGGGGGG + Intronic
1172992591 20:39047598-39047620 GAGGCTGGGATGGGCATGGAGGG - Intergenic
1173720364 20:45253028-45253050 AAGTGTTGCATGGGCATGTGTGG - Exonic
1175074907 20:56364017-56364039 AAGGTTGGCATGAGGATGGAAGG + Intronic
1175329726 20:58155296-58155318 AAGTGGGGCATGGAAATGGGAGG - Intronic
1175822696 20:61918843-61918865 TAGTATTGGATGGGCATGGAAGG - Intronic
1175865304 20:62172839-62172861 ATGTGTGGCAGGGGCAGGGGTGG - Intronic
1176519714 21:7815417-7815439 AGGTGTGGCATGGGCCTGCCTGG + Intergenic
1178653742 21:34445430-34445452 AGGTGTGGCATGGGCCTGCCTGG + Intergenic
1179185995 21:39085725-39085747 AGGGGTGGCAAGGGCTTGGAGGG - Intergenic
1180067670 21:45420723-45420745 AGGTGTGGCATGTGCAGGGAAGG + Intronic
1181848339 22:25731307-25731329 AAGGGTAGTATGGGGATGGAGGG - Intergenic
1182001446 22:26923178-26923200 AAGTAGGGAAAGGGCATGGAAGG + Intergenic
1182768195 22:32774057-32774079 AAGAGTGAGATGGGCTTGGAGGG + Intronic
1182793148 22:32969748-32969770 AGGTGTGACATAGTCATGGAAGG - Intronic
1183165260 22:36142831-36142853 AAGCACGGGATGGGCATGGAAGG - Intronic
1183171663 22:36192987-36193009 AAGCACGGGATGGGCATGGAAGG - Intronic
1183179155 22:36246924-36246946 AAGCACGGGATGGGCATGGAAGG + Intergenic
1183218607 22:36497349-36497371 AAGAGGGGCAGGGGCATGGAGGG + Intronic
1183666510 22:39249281-39249303 ATTTGTGGCATGGTCTTGGACGG - Intergenic
1183936365 22:41264671-41264693 AACTGTGGCATGGGCATTGGCGG - Exonic
1184286744 22:43476311-43476333 AAGTGTGGCTTGATCCTGGAAGG + Intronic
949119321 3:366658-366680 AAGAATTGCATGGGCTTGGATGG + Intronic
949327471 3:2882519-2882541 AAGTGTGCCATTGGCAAGGTAGG + Intronic
949750103 3:7342395-7342417 ATGTCTAGCATGGGCTTGGAAGG - Intronic
950016998 3:9761436-9761458 AAGTGGGGCTTGGCCATGGTAGG - Intronic
950543035 3:13623488-13623510 ACGTGTGCGAGGGGCATGGAAGG - Intronic
950577747 3:13842921-13842943 ATGTGTGGCATGGGGCTGAAAGG + Intronic
951345144 3:21538742-21538764 AACTGTGGTTGGGGCATGGAGGG + Intronic
951993837 3:28705049-28705071 GAGGGTGGCATGCCCATGGAGGG - Intergenic
952675916 3:36030146-36030168 AACTGTGGCAGGGGCAGAGAGGG + Intergenic
953827658 3:46267978-46268000 GAGGGTGGCATGGGCAGGGTAGG + Intergenic
954413124 3:50379926-50379948 AAGTGGGGCTGGGGCAGGGACGG - Intronic
954605799 3:51908206-51908228 AAGGCTGGTCTGGGCATGGAAGG + Intergenic
955033635 3:55244795-55244817 ATTTGGGGCATGGGCATGCATGG + Intergenic
955124200 3:56094179-56094201 AGGTGTGGCATGGGTAAGAAAGG + Intronic
957136686 3:76297350-76297372 AAGTGTGACATGGCAATGGGAGG - Intronic
958549616 3:95595580-95595602 AGGTGGGGCTTGGGCATGGCAGG + Intergenic
959833927 3:110896448-110896470 AAGAGGGGCAGGGGCATGGCAGG - Intergenic
960570075 3:119177050-119177072 AAATGAGGCATTGACATGGATGG + Intronic
961138771 3:124537598-124537620 AAGTGTGGTTTGGGAAAGGAAGG + Intronic
961382600 3:126505573-126505595 AAGGGTGGCCTGGGCAAGGAAGG + Intronic
961577290 3:127848005-127848027 CAGCGTGCCATGGGCATGGAAGG + Intergenic
963674242 3:148288312-148288334 GAGTGTGGCACAGGCAGGGAGGG - Intergenic
963837768 3:150074226-150074248 ATCTGTGGCAGGGGGATGGAGGG + Intergenic
964499144 3:157329240-157329262 AAGAGAGGTTTGGGCATGGATGG - Intronic
966775547 3:183540096-183540118 CATTGTGGCTTGGGCTTGGACGG - Intronic
969285533 4:6200027-6200049 GAGTGGGGGATGGGTATGGAAGG + Intronic
969327308 4:6451477-6451499 AGGTGGGGCAGGGGCAGGGAGGG + Intronic
969490372 4:7496152-7496174 AAGTGTGTCTTGGGAAGGGAGGG + Intronic
971287938 4:25308219-25308241 GAGTGTGGCAGGGACAAGGAAGG + Intergenic
973045455 4:45530839-45530861 GAGTGTGGCATGGGACTGGTGGG + Intergenic
974403659 4:61437845-61437867 AAGTGTTGCAAGGGGAGGGAGGG - Intronic
975485616 4:74932121-74932143 AAGTGTAGCAAGAGCAGGGAGGG + Intergenic
976782094 4:88772389-88772411 AAGTGTAGCATGGGTTTGGGTGG - Intronic
978136162 4:105263255-105263277 AAGTGTGTGTTGGGGATGGAAGG + Intronic
982592159 4:157326996-157327018 GGTTGTGGCATGGGGATGGAGGG + Intronic
982680687 4:158425375-158425397 AAATGTGGCATGGTCAGGCATGG - Intronic
982712885 4:158775568-158775590 GAGGGTGGGATGGGGATGGAAGG + Intronic
984553044 4:181183207-181183229 AAGAGTGGCTTGCGCATAGAAGG - Intergenic
985921544 5:2981220-2981242 AAGTGTGCCCTGGGCATGGGAGG - Intergenic
986403734 5:7405204-7405226 AAGTTTGGCATGGCTATGTAAGG - Intronic
986734702 5:10660355-10660377 CAGTGTGGCCTGGGCAGGGGTGG + Intergenic
987084441 5:14455964-14455986 CAGTGGGGCTTGGGCATGGTGGG + Intronic
987750579 5:22033812-22033834 AAGAGTGGCCTGGGCATGACTGG - Intronic
988320347 5:29686633-29686655 AGGTGTGGCATGGGCCTTGGTGG - Intergenic
992387297 5:76297405-76297427 ACTTGTGGCCTGGGGATGGATGG + Intronic
992403303 5:76431448-76431470 AGGTGTGGCATGGGCACAGATGG + Intronic
992497233 5:77305709-77305731 AAGTTTGGCCTGAGAATGGAGGG + Intronic
992653937 5:78889806-78889828 ATGTGTGGCTTGGCCGTGGAGGG + Intronic
993810550 5:92470764-92470786 GAGGGTGGCATGAGCAGGGAAGG - Intergenic
996186138 5:120477519-120477541 AAGTGTGGCTTGGACCAGGATGG - Intronic
997702979 5:135917841-135917863 AAGGGTGGATTGGGCCTGGAAGG + Intergenic
997936017 5:138111819-138111841 GTGTGTGGCATGGGCATGGGGGG - Intergenic
1000014209 5:157263574-157263596 AAGTGTGGAATGTGGAGGGAGGG + Intergenic
1000652839 5:163838083-163838105 AAGTGTGCCAAGCGCAAGGATGG + Intergenic
1002176067 5:177402225-177402247 GAGAGTGGCTGGGGCATGGAAGG - Exonic
1003709272 6:8570798-8570820 AACTGTGGCAGATGCATGGATGG + Intergenic
1005809018 6:29502254-29502276 AGGTGTGGCCTGGGGATTGAAGG - Intergenic
1006360678 6:33585433-33585455 ATATGTGGCCTGGGCCTGGAAGG + Intergenic
1007247995 6:40476157-40476179 GAGTGTGGATGGGGCATGGAAGG - Intronic
1007336528 6:41158826-41158848 AAGGGTGGACTGGGCAGGGATGG - Intronic
1007686992 6:43672882-43672904 AAGTGTGTGCTGGGCAGGGATGG + Intronic
1008175595 6:48264501-48264523 AAGGGTGGCAGGGGCAATGAGGG + Intergenic
1010126909 6:72443027-72443049 AAGTGTGGTCTGGGAGTGGAAGG + Intergenic
1010893791 6:81342993-81343015 TATTGCTGCATGGGCATGGAGGG - Intergenic
1013248485 6:108311290-108311312 AAGTGTGCCATGGAAAGGGAGGG - Intronic
1013480332 6:110547432-110547454 AAATGTGGCATGGGGGTGGAGGG - Intergenic
1013659440 6:112279847-112279869 CAGGGTGGGATGGGCAGGGAAGG + Intergenic
1013774310 6:113662408-113662430 AGGTGTGGCAGGGACAGGGAGGG + Intergenic
1016379025 6:143454339-143454361 AAGTGTGGCATGGGCACCCCTGG - Intronic
1016411165 6:143785654-143785676 AAGTTTGCCATGGGCAGGGTTGG - Intronic
1017059390 6:150468121-150468143 GAGTATGGCATGGGAAGGGAGGG - Intergenic
1017658238 6:156649983-156650005 AAGTATGGCATGAGCATGTTAGG - Intergenic
1020098499 7:5381354-5381376 AAGTGTGACATGTGCAGAGAGGG - Intronic
1021814719 7:24435982-24436004 AGGAGTGGCATGGGCATACAGGG - Intergenic
1022353574 7:29588904-29588926 TAGTGTGGCAGGTGCATGGGGGG - Intergenic
1022892967 7:34719945-34719967 AAGTGTGGCATGGGCATGGAGGG - Intronic
1023757229 7:43431273-43431295 AATAGAGGCCTGGGCATGGAAGG - Intronic
1024454042 7:49582474-49582496 AAGGGCTGCAAGGGCATGGAAGG - Intergenic
1026221144 7:68398681-68398703 TAGTGTGGCAGGGGCAGGAAGGG + Intergenic
1026680701 7:72464506-72464528 ATGTGTGGGATTGGCATGAAGGG - Intergenic
1028741019 7:94275529-94275551 AAGTGTGGCATGCCAATGCATGG - Intergenic
1030199746 7:106890794-106890816 CAGTGTGGCATGAGGCTGGAGGG - Intronic
1030657426 7:112183552-112183574 AAGGATGGCATGGGCATGTGGGG + Intronic
1031051367 7:116949481-116949503 AAGTGTGGAAAGTGGATGGAAGG + Intergenic
1032439460 7:131931074-131931096 AAGTGTGGCAAGGGTAGTGAAGG - Intergenic
1032706361 7:134423831-134423853 GAGTGTGGCATGGGGCTGGTGGG + Intergenic
1032790858 7:135241469-135241491 GAGTGTGGGGTGGGCATGGAGGG - Intronic
1034516399 7:151584088-151584110 AAGGGAGGCCTGGGCCTGGACGG - Intronic
1036371641 8:8167681-8167703 AACTGTGGCAATGGCATGGGGGG - Intergenic
1036721720 8:11181940-11181962 GAGTGTGGCTTGAGCCTGGAAGG - Intronic
1036879262 8:12497963-12497985 AACTGTGGCAATGGCATGGGGGG + Intergenic
1037749517 8:21671913-21671935 CAGCGTGGCATTGGCATGGATGG - Intergenic
1037998472 8:23370165-23370187 ATGTGTGCCATGGGCAGGGCTGG - Intronic
1039227692 8:35406622-35406644 AAGTGTGGGAAGGCCAGGGAGGG + Intronic
1039451296 8:37676851-37676873 AAGTGGGGAGTGGGGATGGAGGG + Intergenic
1039557162 8:38484779-38484801 AAGTGTGGCCTGGGCTGGGAGGG + Intergenic
1040003672 8:42600165-42600187 AGGGGTGGCTTGGGCATGGCGGG + Intergenic
1041306959 8:56471514-56471536 ATGTGTGGCATGTGCATGTGTGG - Intergenic
1042723053 8:71844510-71844532 AGGTGGGGCAGGGGCGTGGAAGG + Intronic
1044984859 8:97748423-97748445 GATTGTGGCGTGGGCATGGGCGG - Intergenic
1045521057 8:102903754-102903776 AAGTGTGGAAGGGGCCTGGAGGG + Intronic
1045803698 8:106131314-106131336 AAGTGTGACATGCAGATGGAGGG - Intergenic
1046744171 8:117859452-117859474 AAGTGTGGTATGGGTATGAGGGG + Intronic
1047900407 8:129415382-129415404 AAGTCTGGCATGGGTACAGAAGG - Intergenic
1048379930 8:133856622-133856644 AAGTCTCCCATGGGCATGGCAGG - Intergenic
1048581235 8:135731378-135731400 AGGTGTGGCTGGGGCCTGGATGG + Intergenic
1049262510 8:141647027-141647049 AAGTGAGGGAGGGCCATGGAGGG - Intergenic
1049579380 8:143404499-143404521 AGGTGGGGGATGGGCATGGGTGG - Intergenic
1051130376 9:13853593-13853615 GTGTGTGGCATGGGCAGGGGAGG + Intergenic
1051783768 9:20719882-20719904 AATTGTGGCAAGGGCATTGTGGG + Intronic
1052377331 9:27732065-27732087 GAGTGTGGCAGGGGTATTGAAGG - Intergenic
1052774688 9:32721697-32721719 AAGTGTGGCATGGGCAGAAGGGG - Intergenic
1055433257 9:76266548-76266570 GATTCTGGCATGTGCATGGAGGG - Intronic
1055773857 9:79747170-79747192 AAATGTGGCAAGGGTATGAATGG - Intergenic
1056232633 9:84562487-84562509 AAGTGTGGCATGAGGAAAGAAGG + Intergenic
1057725430 9:97564886-97564908 AAGTGGAGCAGGGGCATGGGGGG - Intronic
1057889925 9:98862199-98862221 GAGTGTGACATGGGCAAGGATGG - Intergenic
1060141590 9:121215046-121215068 AAGTTGGGCAAGGGCAAGGAAGG - Intronic
1060408329 9:123383634-123383656 AGGTATGGCATGGGCAAGGGAGG - Exonic
1061110526 9:128566537-128566559 AGGTGTTGCAGGGGAATGGATGG + Intronic
1061910028 9:133717501-133717523 AGGTTTGGCATGGGGATGCATGG - Intronic
1061932004 9:133838143-133838165 AGAGGTAGCATGGGCATGGAGGG - Intronic
1062148228 9:135002589-135002611 AAGTGGGGCCTGAGCTTGGATGG + Intergenic
1062684810 9:137806314-137806336 AAGCGTGGCAGGGACAGGGATGG - Intronic
1189266630 X:39721724-39721746 AAGTGTGGCATGCGTTTGGAAGG - Intergenic
1190327094 X:49213160-49213182 AAGTGGGTAATGGGAATGGAAGG + Intronic
1191655023 X:63586688-63586710 TAGTGGAGCATGGCCATGGATGG - Intergenic
1191831823 X:65423219-65423241 AAATGTGGCATGGCCAGGCACGG - Intronic
1192586332 X:72321129-72321151 AATTGTGACATGGGCATATAAGG - Intergenic
1198673337 X:139105210-139105232 AATTGTAGCATGGCCATTGAGGG - Intronic
1200373571 X:155755407-155755429 TAGTGTGGCATGGGAGTTGAGGG + Intergenic