ID: 1022893298

View in Genome Browser
Species Human (GRCh38)
Location 7:34723142-34723164
Sequence CTAGGCTGCTTGGCAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022893292_1022893298 -1 Left 1022893292 7:34723120-34723142 CCCAAGATAATGCTGCTCAGTTC 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 231
1022893290_1022893298 18 Left 1022893290 7:34723101-34723123 CCATCCTGGCTGCAGCAATCCCA 0: 1
1: 0
2: 3
3: 43
4: 382
Right 1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 231
1022893293_1022893298 -2 Left 1022893293 7:34723121-34723143 CCAAGATAATGCTGCTCAGTTCT 0: 1
1: 0
2: 3
3: 20
4: 142
Right 1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 231
1022893291_1022893298 14 Left 1022893291 7:34723105-34723127 CCTGGCTGCAGCAATCCCAAGAT 0: 1
1: 0
2: 3
3: 14
4: 145
Right 1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 231
1022893289_1022893298 22 Left 1022893289 7:34723097-34723119 CCGTCCATCCTGGCTGCAGCAAT 0: 1
1: 0
2: 2
3: 18
4: 275
Right 1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022893298 Original CRISPR CTAGGCTGCTTGGCAGAAAG GGG Intronic
900228926 1:1546188-1546210 CTAGGCTGTTTATCTGAAAGTGG - Intronic
900507746 1:3038209-3038231 CCAGGCTGCTGGGCAGGAAGGGG - Intergenic
901177899 1:7318041-7318063 CTAGCATGCTTGAAAGAAAGGGG + Intronic
902258616 1:15207139-15207161 TTATGCAGCTTGGCAGGAAGAGG + Intronic
902397181 1:16138802-16138824 CTAGTCTGCATGGAGGAAAGGGG - Intronic
903713269 1:25342268-25342290 CTAGGCTACTTGTCAGAATTTGG + Intronic
904298439 1:29538921-29538943 AGAGGCTGCTTTGCAGAATGAGG + Intergenic
905005068 1:34703033-34703055 CTAGTCTTCTTGGGAGAAATTGG + Intergenic
905279764 1:36841639-36841661 CTGGGCAGCCTGGCAGAAAAAGG - Intronic
905523132 1:38615391-38615413 CGAGGCTCCTAGGCAGAGAGAGG - Intergenic
907020179 1:51059515-51059537 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
907915675 1:58866682-58866704 TTAGGCTCATTGGCAGAAAGAGG - Intergenic
909479535 1:76116571-76116593 TTAGGCTGCTTGACAGAACTTGG - Intronic
912261307 1:108113723-108113745 CTAAGCTGCTTGGCAGGACCAGG + Intergenic
913428880 1:118766811-118766833 CGAGCCTCCTTGGCAGAAAAAGG - Intergenic
917441665 1:175074035-175074057 ACAGGCTGCATGGCAGAGAGAGG - Intronic
917453063 1:175163176-175163198 CTGGGCTGCTTGCCAAAAATGGG - Intronic
918094202 1:181321284-181321306 CTAGGTTGCCAGGCAAAAAGTGG - Intergenic
918148490 1:181778730-181778752 GTTGGCTGAGTGGCAGAAAGAGG + Intronic
919263989 1:195237764-195237786 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
919513469 1:198494254-198494276 ATAGGCTCCTGGGCAGAAGGGGG - Intergenic
919747108 1:201015693-201015715 CTAGTCTGCCTGGCACACAGGGG + Intronic
920602756 1:207346089-207346111 TCAGGCTACTTGGCAGCAAGTGG + Intronic
1062837651 10:646433-646455 CAAAGCTGCCTGGCAGCAAGAGG + Intronic
1066270626 10:33819516-33819538 CCAGGCTGCCTGGCAAGAAGGGG + Intergenic
1069625890 10:69867459-69867481 CAAGGCTGCTTTGCAGAACACGG - Intronic
1069691818 10:70358697-70358719 CTAGGCTGGTGGGCAGAGAGGGG - Intronic
1070023791 10:72611869-72611891 CTCGGCTGCTTGGGAAAATGAGG + Intronic
1071819424 10:89264857-89264879 ATAGGCCCCTGGGCAGAAAGGGG - Intronic
1072623812 10:97098364-97098386 CCAAGCTGCTAGGCAGAGAGGGG + Intronic
1072871364 10:99124406-99124428 ACAGGCTTCTGGGCAGAAAGTGG - Intronic
1073177534 10:101565560-101565582 CTAGGCTGATCTGCAGCAAGAGG - Intergenic
1073376711 10:103041505-103041527 CAAGGCTACTTGGCAGAAGCAGG + Intronic
1073586183 10:104712316-104712338 AGAGGCTGCGTGGCAGAAAGGGG - Intronic
1074301840 10:112240460-112240482 ACAGGCTCCTGGGCAGAAAGGGG - Intergenic
1074422580 10:113322397-113322419 CTAGGCTTGTAGGCAGAAAGTGG + Intergenic
1078365667 11:10704455-10704477 GTAGGCTGGTGGGGAGAAAGAGG + Intergenic
1078934739 11:15941034-15941056 CCAGGCTGCTGGGCAGGCAGAGG - Intergenic
1084549927 11:69835091-69835113 CTGGGCTGCTGGGCAGGAGGGGG + Intergenic
1085212195 11:74791384-74791406 ACAGGCTCCTGGGCAGAAAGGGG - Intronic
1085334248 11:75678981-75679003 ACAGGCTTCTGGGCAGAAAGTGG - Intergenic
1085946510 11:81279182-81279204 TTAAGCTGCTTTGCAGAAATGGG + Intergenic
1086175338 11:83884659-83884681 TTAGGCTGCTTGGTAGTCAGGGG - Intronic
1086268271 11:85028431-85028453 ACAGGCTCCTGGGCAGAAAGGGG - Intronic
1087131372 11:94671979-94672001 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
1087407895 11:97752497-97752519 ACAGGCTTCTAGGCAGAAAGGGG - Intergenic
1088328838 11:108629216-108629238 GCAGGCTCCTGGGCAGAAAGGGG - Intergenic
1089138243 11:116266468-116266490 CAGGGCTGCACGGCAGAAAGGGG + Intergenic
1092266146 12:6982072-6982094 CAAGGCTTCTTGGCAAAATGAGG + Intronic
1093186946 12:16030889-16030911 TAAGGCTGCCTGGGAGAAAGTGG - Intronic
1093223158 12:16447676-16447698 CCAGGATGCCTGGCTGAAAGTGG - Intronic
1095261011 12:40099724-40099746 CTAGGCTGCCAGACAGAAAAGGG + Intronic
1095603167 12:44037512-44037534 ATAGGCTCCTAGGCAGAAAGGGG + Intronic
1096828971 12:54300177-54300199 CTTGGCTGCTTGGGAAATAGGGG - Intronic
1096857126 12:54491812-54491834 CTAGGCTGCTGGCCAAAATGAGG - Intergenic
1099033709 12:77560012-77560034 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
1100060289 12:90566599-90566621 CTATGCTGCATGGCAGAGGGGGG + Intergenic
1101580909 12:106040233-106040255 ATAGGTTCCTGGGCAGAAAGGGG - Intergenic
1104034173 12:125087104-125087126 CTAGGCAGAGTGGAAGAAAGTGG - Intronic
1106325417 13:28684444-28684466 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
1106379512 13:29223085-29223107 ATGGGCTTCTGGGCAGAAAGGGG + Intronic
1106979141 13:35256527-35256549 AAAGGCTCCTGGGCAGAAAGGGG - Intronic
1108334820 13:49428737-49428759 CTAGGCTCCTTGGCACTTAGTGG - Intronic
1108788533 13:53937593-53937615 TTAGGCTGCTTGTCTGCAAGAGG - Intergenic
1109303586 13:60614920-60614942 TTAGGGTCCTGGGCAGAAAGAGG - Intergenic
1109348447 13:61145456-61145478 ACAGGCTCCTGGGCAGAAAGAGG + Intergenic
1109396519 13:61766292-61766314 ACAGGCTGCTGGGTAGAAAGTGG - Intergenic
1111330283 13:86757324-86757346 CCAGGCTGCTTGACAGGCAGAGG + Intergenic
1111500845 13:89118462-89118484 CTGGGCTGCAGTGCAGAAAGAGG - Intergenic
1111719612 13:91925581-91925603 CTAGTCTGTTTTGAAGAAAGTGG + Intronic
1113503049 13:110793403-110793425 ACAGGCTCCTTGGCAGAAAGGGG + Intergenic
1116159763 14:41253612-41253634 GCAGGCTCCTGGGCAGAAAGGGG - Intergenic
1116617250 14:47154811-47154833 ATAGGCGGCTGGGCGGAAAGGGG + Intronic
1117475281 14:56088150-56088172 CCAGAGTTCTTGGCAGAAAGAGG + Intergenic
1117544060 14:56776859-56776881 CGGGGCTGCTTGGCAGTCAGGGG + Intergenic
1117782073 14:59243639-59243661 CCAGGCTGTTGTGCAGAAAGAGG - Intronic
1123739660 15:23224818-23224840 CTAGTCTGTTTTGAAGAAAGTGG + Intergenic
1124061185 15:26294923-26294945 GGAGGGTGCTTGGAAGAAAGCGG - Intergenic
1124290884 15:28453794-28453816 CTAGTCTGTTTTGAAGAAAGTGG + Intergenic
1125194483 15:37030754-37030776 CCTGGCTGCTTGGCAGTATGAGG - Intronic
1126878285 15:53067472-53067494 CTGAGCTGATTGGCAGAAGGAGG + Intergenic
1128145508 15:65330504-65330526 CTAGGGGGCTTGGCAGAGTGCGG - Intronic
1128217804 15:65946360-65946382 GGAGGCTGCTTGGCAGAGTGGGG - Intronic
1130028229 15:80288449-80288471 CTAGGCTGTTCTGCAGAATGTGG - Intergenic
1131056723 15:89379241-89379263 CGTGGCTGCTGGGGAGAAAGAGG + Intergenic
1131822338 15:96285830-96285852 CAGAGCTGCTTGACAGAAAGAGG + Intergenic
1133451947 16:5911139-5911161 CTGGGGTGCTTGGCAGACATAGG + Intergenic
1133497937 16:6337566-6337588 CTGGGCTGCTTGTAAGAATGTGG - Intronic
1136040078 16:27571741-27571763 CTGAGCTGCTAGGCACAAAGCGG - Intronic
1137365902 16:47859239-47859261 CGAGGCTGCATGGCAGTAAGTGG + Intergenic
1138029106 16:53545630-53545652 CTCGCCTGCTTGCCAGGAAGAGG - Intergenic
1138064136 16:53923067-53923089 TTAGGCTGCTTGGAAAACAGAGG + Intronic
1138585808 16:57969931-57969953 CCAGGGTCCCTGGCAGAAAGGGG - Intronic
1139138508 16:64233566-64233588 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
1140103478 16:71938442-71938464 ACAGGCTCCTGGGCAGAAAGGGG + Intronic
1140124529 16:72108579-72108601 CTTGGCTGCTTGGTGGAAATAGG - Exonic
1140237710 16:73173830-73173852 CAAGCCTGTATGGCAGAAAGGGG + Intergenic
1144093059 17:11875008-11875030 CGTGGCTGCCTGGCAGAACGAGG + Exonic
1144389957 17:14784330-14784352 ATAGGCTCCTGGGCAGAAAGGGG + Intergenic
1146284926 17:31567933-31567955 CCTGGCTGCTGGGGAGAAAGAGG + Intergenic
1147167675 17:38602100-38602122 CTAGGCTGCTTGGCAGGAGTTGG + Intronic
1151335144 17:73435302-73435324 CCAGGCTGCTGGGCAGCAGGCGG + Intronic
1151490158 17:74427967-74427989 CTTGCCTGCTTCTCAGAAAGTGG + Intronic
1153608158 18:6855133-6855155 ACAGGTTGCTGGGCAGAAAGGGG + Intronic
1153790326 18:8572943-8572965 CTAGGCTGATTCAGAGAAAGTGG - Intergenic
1157802857 18:50635121-50635143 CTATGGTGCTTGGCACAGAGTGG + Intronic
1157844046 18:50985872-50985894 TTAGTCTTCTTGGCAGACAGGGG - Intronic
1159060651 18:63510720-63510742 CTAGGCAGCCTGCAAGAAAGAGG - Intergenic
1160458481 18:79019526-79019548 CTAGTCTGCTTTGCAGAAGTGGG - Intergenic
1163828433 19:19536354-19536376 CAAGGCTCCTAGGCTGAAAGTGG + Intronic
1164455890 19:28406291-28406313 CTGGGCTGCCTTGCAGAGAGGGG + Intergenic
1164563453 19:29309756-29309778 CGAGGCTGTCTGGCAGAGAGAGG - Intergenic
1166155595 19:40909144-40909166 CTAGGCTACACGGCAGAGAGGGG + Intergenic
1166379844 19:42350211-42350233 CTGGGCTGCTTGGCAGACCAGGG + Exonic
1166594008 19:44028256-44028278 CTAGCCAGCTAAGCAGAAAGTGG - Intronic
1167439547 19:49500402-49500424 CCAGGCTGCTGGGAAGGAAGTGG + Intergenic
927613600 2:24566650-24566672 ATAGACTTCTGGGCAGAAAGGGG - Intronic
931671432 2:64652339-64652361 CTGGGCTGCTTGGCCGATGGGGG - Intronic
932398295 2:71463046-71463068 ACAGGCTCCTGGGCAGAAAGGGG - Intronic
932644658 2:73488119-73488141 ACAGGCTCCTGGGCAGAAAGGGG - Intronic
934616205 2:95772799-95772821 CTCTCCTGCCTGGCAGAAAGTGG - Intergenic
934644690 2:96051761-96051783 CTCTCCTGCCTGGCAGAAAGTGG + Intergenic
934838105 2:97607851-97607873 CTCTCCTGCCTGGCAGAAAGTGG + Intergenic
937408070 2:121649133-121649155 CCAGGCTGCTTTGCAGAGGGAGG - Intronic
940398732 2:153222530-153222552 ACAGCCTGCTGGGCAGAAAGGGG - Intergenic
941432320 2:165427187-165427209 ATGGGCTCCTGGGCAGAAAGGGG + Intergenic
941693549 2:168527104-168527126 GGAGGCTGCTTGGCTGGAAGAGG + Intronic
942437977 2:176002025-176002047 CTAGGCCACTTGGCAGGAGGCGG + Intronic
943928512 2:193819717-193819739 ATAGGCTCCTGAGCAGAAAGGGG - Intergenic
946127246 2:217573817-217573839 GTAGCCTGCTTGGCAGTGAGCGG - Intronic
947117923 2:226791604-226791626 CCAGGCAGGGTGGCAGAAAGCGG + Intronic
947746584 2:232511193-232511215 CTAGGGTGCTGGGCACACAGGGG - Intergenic
1169255282 20:4092089-4092111 CTAGGCTGCTTGTCCAAAAGCGG + Intergenic
1169317079 20:4601744-4601766 CTAGGCTGCTTGCCAGGAGCTGG - Intergenic
1169564625 20:6840456-6840478 CAAGGTTGCTGAGCAGAAAGTGG - Intergenic
1170102585 20:12718817-12718839 ATAGTCTTCTTGGCAGAAAATGG + Intergenic
1172216940 20:33242322-33242344 CTGGGCTGGTTGGTAGAAGGAGG + Intronic
1172409639 20:34711595-34711617 CTAGGTTGCTGGGGAGAAATGGG + Exonic
1173077478 20:39833270-39833292 CTTGACTGGTTGGCTGAAAGTGG + Intergenic
1174446677 20:50595498-50595520 CTGGGCTGCTTCCCAGAAACTGG - Exonic
1174479942 20:50824208-50824230 CTCTGCTCCTTGGCAGAAGGTGG - Intronic
1175983627 20:62753575-62753597 CCGGGCAGCTTGGCAGAGAGGGG + Intronic
1176039987 20:63060254-63060276 CGATGGTGTTTGGCAGAAAGTGG + Intergenic
1176973291 21:15290195-15290217 ACAGGCTCCTGGGCAGAAAGGGG - Intergenic
1177344915 21:19855572-19855594 ATAGGCTCCTGGGCAGAAAGGGG - Intergenic
1178931258 21:36820748-36820770 ACAGGCTCCTGGGCAGAAAGTGG + Intronic
1183231713 22:36586447-36586469 CCAGGCAGCTGGGAAGAAAGAGG - Intronic
1183657830 22:39200140-39200162 CTAGGCTCTTTGTCAGACAGCGG - Intergenic
1183913105 22:41093032-41093054 TTAGGCCGCTTGGCTGAAGGCGG - Exonic
1184388228 22:44188218-44188240 CTAGGCTGCTAGAGAGAAAACGG + Intronic
950962732 3:17122664-17122686 CTCACCTGCTTGGGAGAAAGTGG - Intergenic
952093035 3:29914227-29914249 CTAGGTGGCTAGGTAGAAAGTGG + Intronic
952988079 3:38805170-38805192 CTTAGCTGCTTGGCAGAATAAGG + Intergenic
953766537 3:45747384-45747406 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
956702083 3:71967336-71967358 CTACCAGGCTTGGCAGAAAGAGG + Intergenic
958116196 3:89221109-89221131 CTATGCTTCCTGGCAGAGAGAGG + Intronic
959373501 3:105558985-105559007 CTAAGCTGCAAGGCAGAGAGGGG - Intronic
961440846 3:126952391-126952413 CTGGGCTGCATGGCAGGCAGGGG + Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963805125 3:149714671-149714693 ATAGGCTCCTGGGCAGAATGGGG + Intronic
967227535 3:187306223-187306245 CTTGGCTGTTTGGCCGAGAGCGG + Intergenic
968446756 4:655980-656002 CCAAGCTACGTGGCAGAAAGCGG + Exonic
970137213 4:12938011-12938033 CTAGGCTGCCTGGCAGACAAAGG - Intergenic
971057120 4:22926160-22926182 GGAGGATGCTTGGAAGAAAGAGG - Intergenic
971092407 4:23360822-23360844 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
971371668 4:26024308-26024330 CTGGGCTGCTTGCTAGTAAGTGG + Intergenic
971795539 4:31222424-31222446 CTTGGCTACTTGGCAGACTGAGG - Intergenic
972788160 4:42346406-42346428 ACAGGCTTCTGGGCAGAAAGGGG + Intergenic
973604778 4:52575641-52575663 CTAGGCTGCTTGGGAGGCTGAGG + Intergenic
974235791 4:59179717-59179739 ATAGGCTCCTGTGCAGAAAGGGG + Intergenic
974747573 4:66095042-66095064 CTATGCTACTGGGCAGAAATTGG - Intergenic
979010774 4:115365811-115365833 ACAGGCTCCTGGGCAGAAAGAGG + Intergenic
979956132 4:126955843-126955865 ACAGGCTTCTGGGCAGAAAGGGG + Intergenic
981889226 4:149716092-149716114 ACAGGCTCCTGGGCAGAAAGGGG - Intergenic
984245750 4:177273746-177273768 CTAGCCTGGATGACAGAAAGAGG - Intergenic
984974408 4:185217964-185217986 CTAGGTTGCTTGGTTGAATGGGG + Intronic
985866069 5:2515574-2515596 CTGGGCTGCTGGGCAGACGGCGG + Intergenic
986541149 5:8844923-8844945 CTGGGCTGCCAGGCAGAATGGGG + Intergenic
987537693 5:19208975-19208997 ACAGGCTTCTGGGCAGAAAGGGG + Intergenic
988400062 5:30750948-30750970 GTAGTCAGCTTGGCAGCAAGTGG + Intergenic
988954571 5:36301960-36301982 CTAGGATGATTAGCATAAAGAGG + Intronic
989399682 5:40995319-40995341 CTATGCTGCATGCCAGGAAGGGG + Intergenic
989537599 5:42582203-42582225 ACAGGCTCCTGGGCAGAAAGAGG + Intronic
991230858 5:64331269-64331291 ACAGGCTCCTGGGCAGAAAGGGG + Intronic
994692398 5:103034763-103034785 ACAGGCTTCTGGGCAGAAAGGGG - Intergenic
995386591 5:111595957-111595979 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
995742401 5:115368789-115368811 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
996452257 5:123638695-123638717 CTGGGCTGCTTGGCAGGGAGCGG + Intergenic
996470350 5:123852935-123852957 CTAGACCCCTTGGCAGACAGTGG + Intergenic
998320031 5:141220921-141220943 CTAGCTCGCTTGGAAGAAAGAGG + Intergenic
1000854253 5:166379429-166379451 ATAGGCTCCTGGGCAGAAAGGGG - Intergenic
1001112898 5:168912892-168912914 CCAGGCTGGATGGCACAAAGGGG - Intronic
1001515941 5:172355367-172355389 CTAGGCTGCTGGGCTGGGAGGGG + Intronic
1004525418 6:16402804-16402826 CAAGGCTGCTTGGCTGAAGATGG + Intronic
1006812324 6:36827906-36827928 CCAGGCTGCTGTGCAGACAGCGG - Intronic
1007450707 6:41939184-41939206 CTGAGCTACTTGGCAGGAAGAGG + Intronic
1007998642 6:46335561-46335583 CAAGACTGCTTGGGAGAAGGAGG - Intronic
1008172093 6:48220486-48220508 ATAGGCTGCTTGGAAGAGAATGG - Intergenic
1009530227 6:64803558-64803580 ACAGGCTCCTGGGCAGAAAGGGG - Intronic
1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG + Intronic
1023016434 7:35972040-35972062 CAAGACTGCTAGCCAGAAAGTGG - Intergenic
1026714346 7:72774190-72774212 CTAGTCTGACTGGCAGAAACAGG - Intronic
1027995773 7:85423869-85423891 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
1029922807 7:104283630-104283652 TTAGGATGCTTGGGATAAAGGGG + Intergenic
1030981125 7:116186390-116186412 ACAGGCTCCTGGGCAGAAAGGGG - Intergenic
1034210430 7:149358239-149358261 ACAGGCTCCTGGGCAGAAAGGGG - Intergenic
1034470627 7:151252579-151252601 GTAGGCTGGATGGCGGAAAGTGG - Intronic
1036214459 8:6867291-6867313 CTGGGCTGGTTGGAAGAAATTGG + Intergenic
1038021766 8:23557220-23557242 CTAGGCTCCTTGGCAGAAGAGGG - Intronic
1040537085 8:48319840-48319862 CTAGGATGCCTAGAAGAAAGAGG + Intergenic
1041417125 8:57623153-57623175 CTATGCTACATGGCATAAAGAGG - Intergenic
1041853289 8:62418540-62418562 CTAGACTGGGTGGTAGAAAGGGG - Intronic
1041956033 8:63558868-63558890 ACAGGCTACTGGGCAGAAAGGGG + Intergenic
1043241583 8:77941214-77941236 TTAGGCTGCTTGGCAGTCAGGGG - Intergenic
1043466535 8:80513431-80513453 CTAGACTGCTTAGCTGGAAGTGG - Intronic
1044744441 8:95358419-95358441 CTAGGGTATGTGGCAGAAAGAGG + Intergenic
1045324778 8:101109956-101109978 CGAGGCTGCATGGGGGAAAGGGG - Intergenic
1046273587 8:111927464-111927486 CTAGGTTTCTAGGCTGAAAGTGG - Intergenic
1047339833 8:123970296-123970318 CTATGCTTCTTGGAAGCAAGTGG + Intronic
1047424589 8:124733770-124733792 CTGGGCAGTTTGGCAGGAAGCGG + Intergenic
1047750088 8:127873955-127873977 CTTGGCTGCTTGGCAGCTAGTGG - Intergenic
1047920868 8:129633204-129633226 ATAGGCTGCTTGGCATTAAAAGG - Intergenic
1048339145 8:133525540-133525562 ACAGGCTCCTGGGCAGAAAGGGG - Intronic
1048969978 8:139640015-139640037 CAGGGCTGCTTGGCAGGAAGTGG - Intronic
1049358924 8:142202613-142202635 CTCGGCTGCATGGCACAGAGAGG + Intergenic
1053188328 9:36037383-36037405 CTCTGCTGCTTGTCAGAAAAGGG + Intronic
1053399176 9:37801751-37801773 CTAGGATGATGGGGAGAAAGCGG - Intronic
1053445048 9:38146278-38146300 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
1054909652 9:70442578-70442600 CCCGGCTGCTTGGCAGACTGAGG + Intergenic
1055860767 9:80746968-80746990 TTAGGCTGCTTGGGAGTCAGGGG + Intergenic
1056994456 9:91443369-91443391 ACAGGCTTCTGGGCAGAAAGGGG - Intergenic
1057214925 9:93222575-93222597 CTAGACTTCTTTGCAGAAAAGGG - Intronic
1058728199 9:107823750-107823772 CTACCCTGCTTTGCAGAATGTGG - Intergenic
1058728293 9:107824630-107824652 ATATGCTTCTGGGCAGAAAGAGG + Intergenic
1059104765 9:111501718-111501740 ATAGGCTCCTGGGCGGAAAGGGG + Intergenic
1059844834 9:118263517-118263539 CAAGGTTGCTTTGCAGAAATGGG - Intergenic
1060415037 9:123424154-123424176 ATAGCCTGCTTGGAGGAAAGAGG - Intronic
1060702359 9:125767758-125767780 CTAGGCTTCTCAGAAGAAAGTGG - Intronic
1062344205 9:136107322-136107344 CTGGGCTGATTGGCAGGAAGAGG - Intergenic
1185461663 X:335475-335497 CTGTGCTGCTTGGCAGGAATCGG + Intronic
1191867943 X:65720679-65720701 CTAGACTCCTTGGCAGGAATTGG + Intronic
1192508838 X:71709728-71709750 CTAGGATGTTTGTCAGAATGTGG - Intergenic
1192517859 X:71771825-71771847 CTAGGATGTTTGTCAGAATGTGG + Intergenic
1194862097 X:99012213-99012235 TTAGAGTGTTTGGCAGAAAGTGG + Intergenic
1197035626 X:121870370-121870392 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
1197342186 X:125287522-125287544 GCAGGCTCCTAGGCAGAAAGGGG + Intergenic
1197929241 X:131678326-131678348 CCAGGCTACTGGGCAGAAGGAGG - Intergenic
1197972377 X:132128974-132128996 ATAGGATTCTTGGCTGAAAGTGG + Intergenic
1198189469 X:134288011-134288033 ACAGGCTCCTGGGCAGAAAGGGG + Intergenic
1201405308 Y:13643970-13643992 TTAGCCTGCTTGGCTGGAAGTGG - Intergenic
1201687107 Y:16717416-16717438 CAAGACTGCTTGGCAGATATTGG + Intergenic