ID: 1022897164

View in Genome Browser
Species Human (GRCh38)
Location 7:34762114-34762136
Sequence TTGGGGGAACTAATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022897157_1022897164 6 Left 1022897157 7:34762085-34762107 CCTTAATTAGACACAAGCTTTTT 0: 1
1: 0
2: 1
3: 17
4: 245
Right 1022897164 7:34762114-34762136 TTGGGGGAACTAATGGAGAAAGG 0: 1
1: 0
2: 0
3: 18
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022897164 Original CRISPR TTGGGGGAACTAATGGAGAA AGG Intronic
901201335 1:7469062-7469084 TTCTGGGAACTGAGGGAGAATGG - Intronic
902111258 1:14080371-14080393 CGGGGGAAACTAATGGAGTAAGG + Intergenic
904109077 1:28111161-28111183 AAGGGGGAAGTAATGGATAATGG - Intergenic
904490107 1:30853428-30853450 ATGGGAGAAATAATGAAGAAGGG - Intergenic
904956771 1:34291104-34291126 TTGGGGGAACAATGGGACAAGGG + Intergenic
905765522 1:40596902-40596924 TTGGGGGAAAAAAGGGAGCAAGG - Intergenic
907854113 1:58284424-58284446 TTGGGGGAACTGAGAGAGAGAGG - Intronic
909277412 1:73705356-73705378 TTGGGGGATGGAATGGAGAAGGG + Intergenic
910408973 1:86920199-86920221 ATGGGGAAAATAATTGAGAATGG + Intronic
910977043 1:92917753-92917775 TGGGAGGAACTAGTGGAGCAAGG + Intronic
912914631 1:113801418-113801440 TGGTGGCAACTAATTGAGAATGG + Intronic
913397762 1:118391010-118391032 TGGGGGGAAGTAAAGAAGAAAGG + Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
916261782 1:162849513-162849535 TTCAGGGAACTAAGGGTGAATGG - Intronic
917493982 1:175523591-175523613 TTGGGTGGATTCATGGAGAACGG + Intronic
917801264 1:178572763-178572785 TTGGGGCAACTAAGGGGGAAAGG - Intergenic
918713707 1:187763517-187763539 TTGAGGAAATTATTGGAGAAGGG - Intergenic
919656722 1:200203791-200203813 TTGGTGGAAATAGTGGAAAATGG + Intergenic
919818565 1:201457971-201457993 TTGGTGGCAGTGATGGAGAAGGG - Intergenic
919981981 1:202647467-202647489 TTGGGGGTGCTCATGGAGTACGG - Intronic
920509563 1:206540793-206540815 TTGGGGGATTTAAGGGAGCAGGG + Intronic
922904777 1:229165733-229165755 TGGGGTGAGTTAATGGAGAATGG - Intergenic
923967296 1:239156103-239156125 TTGGGGTAAGGTATGGAGAAAGG + Intergenic
1063023772 10:2156892-2156914 TTGGGGGCCCTAATGGACAGAGG + Intergenic
1063073764 10:2693409-2693431 TTGGAGGAAGTAATGAAGTACGG - Intergenic
1063423866 10:5936300-5936322 TTAGAGGAAGTAAGGGAGAACGG + Intronic
1064755228 10:18567139-18567161 ATGGAGGATGTAATGGAGAATGG - Intronic
1064925471 10:20564457-20564479 TTAGGTGAATGAATGGAGAATGG + Intergenic
1067755519 10:49001647-49001669 TTCGGGGCAGTAATGGAGAGTGG + Intergenic
1067836950 10:49647339-49647361 TTGGGGGAATAAAAGGAGGATGG - Intronic
1069160607 10:65086553-65086575 TTGGGGGAACTGGTGGTGATTGG - Intergenic
1071002188 10:80842677-80842699 TTGTGGGAACTAATAGAGTGAGG - Intergenic
1071942322 10:90603660-90603682 TTGGGGGAAGTAATGGAATGGGG - Intergenic
1073269878 10:102253302-102253324 GTGGGGGAACTAACAGGGAAGGG - Intronic
1075029057 10:119008917-119008939 TACTGGGATCTAATGGAGAAAGG + Intergenic
1075041780 10:119113583-119113605 TTGGGGGCACTGAGGGTGAAGGG + Intronic
1075326637 10:121537881-121537903 TTGTTGTAACTAATGAAGAAAGG - Intronic
1076733591 10:132449454-132449476 TTGGGAGGAGAAATGGAGAACGG + Intergenic
1076943956 10:133631024-133631046 TTGGGTGAACTAGTGGCAAATGG - Intergenic
1078681138 11:13477050-13477072 TTGGGGGATGTGATAGAGAAAGG + Intergenic
1079789853 11:24723045-24723067 ATGGGCAAACTAATGGAAAAAGG + Intronic
1079792144 11:24751572-24751594 TTAGGGGATCTAAGGGAGATGGG - Intronic
1082109896 11:48262923-48262945 TTGGAGGAAGGTATGGAGAAGGG + Intergenic
1083743381 11:64722695-64722717 TTGGGGGAAGGGATGGAGAGAGG - Intronic
1083938592 11:65883139-65883161 ATGGGGGAGCTGATGGGGAAGGG + Intronic
1085034089 11:73289731-73289753 TTGGGGGGAACAATGGAGAAGGG + Intronic
1085692604 11:78676098-78676120 TGGGGGGAAAGAATGGGGAACGG - Intronic
1086854485 11:91849747-91849769 GTGGTGGAAATATTGGAGAAAGG - Intergenic
1090347511 11:126083072-126083094 TAGCGGGGACTGATGGAGAAAGG - Intergenic
1091775013 12:3178872-3178894 GTGGGGGATCTGATGGACAATGG + Intronic
1091848413 12:3676034-3676056 TTGGTGGAAGTGATGGAGCAAGG - Intronic
1092008590 12:5089475-5089497 CTGGGGGAACTCCTGGAGACAGG - Intergenic
1096803197 12:54125389-54125411 TTGGAGGATGGAATGGAGAAAGG + Intergenic
1097456571 12:59805944-59805966 TTGGTGGAAGTGATGGTGAAAGG - Intergenic
1097804529 12:63950903-63950925 GTGGGGCAACTAATGCATAATGG - Intronic
1098047181 12:66412005-66412027 TTGGGGTACCTGAAGGAGAAGGG + Intronic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1102046270 12:109832247-109832269 TTGGGGGAACAAGGGTAGAAAGG - Intronic
1105652025 13:22389429-22389451 TTGGGGGAAGAGATGGTGAAGGG + Intergenic
1106205456 13:27589569-27589591 TTAGGAGAACTAAAGGTGAAGGG - Intronic
1106677296 13:31974426-31974448 TTGGGAGGAGTAATGGGGAAAGG - Intergenic
1106879550 13:34114442-34114464 TTGGGTTAACTTATGGAGAATGG - Intergenic
1108849423 13:54708805-54708827 TGGATTGAACTAATGGAGAAAGG + Intergenic
1110240881 13:73265240-73265262 TTGGGGGATCTGATGGCAAAAGG + Intergenic
1110706911 13:78607716-78607738 ATGGAGGAAGGAATGGAGAAAGG + Intergenic
1112690457 13:101887589-101887611 TAGGGGTAAATAATGAAGAAAGG + Intronic
1113682140 13:112251941-112251963 TTGGGAGCAGTAATGAAGAATGG - Intergenic
1116595292 14:46834498-46834520 GTGGGGGGACTAATTCAGAATGG + Intergenic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118798404 14:69166733-69166755 TTGGGGGAAATGCTTGAGAATGG + Intergenic
1120101954 14:80455091-80455113 GTGGGGGAAATGATGGAGAGTGG - Intergenic
1120677470 14:87437785-87437807 TTAGGGGAAATAATGGAGAGAGG - Intergenic
1120878728 14:89398088-89398110 TTGGGGAAGCCAAAGGAGAAGGG - Intronic
1121387844 14:93545491-93545513 TTGGGAGACCTCAAGGAGAAAGG - Intronic
1121429314 14:93875689-93875711 TTGTGGGTAGTGATGGAGAAAGG + Intergenic
1124708374 15:31984228-31984250 TTGTGGGAAATAATAGAGCAAGG - Intergenic
1126157579 15:45579823-45579845 TAGGAGGACCTAATAGAGAAAGG - Intergenic
1127978442 15:64016257-64016279 TTTGGGAAACTCATGGATAAGGG - Intronic
1131137270 15:89947214-89947236 TGGGGGAAACTAATGGAATAAGG + Intergenic
1131925873 15:97383338-97383360 TTTAGGGAACTGAGGGAGAAAGG + Intergenic
1132172100 15:99669477-99669499 TTGGGAGCACTAAAGGATAAAGG - Intronic
1134656328 16:15950377-15950399 TTGGGGGAACCAGGGAAGAAGGG + Intronic
1137549747 16:49429330-49429352 TTTGGTGAGCTAATGGACAAGGG - Intergenic
1138091064 16:54174980-54175002 CTGAGGGAGCTAATGGAGCAAGG + Intergenic
1138949909 16:61899541-61899563 GGAGGAGAACTAATGGAGAAGGG + Intronic
1139636312 16:68260483-68260505 TTCTGGGAACCTATGGAGAAAGG + Exonic
1139759601 16:69173987-69174009 TTAGGGGAAAAAAAGGAGAAAGG - Intronic
1139774148 16:69303600-69303622 TTGGGGCTGCTAATGGACAAAGG - Exonic
1140079562 16:71732510-71732532 TTGGGGGAACCAGTAGAAAAAGG + Exonic
1140528762 16:75646612-75646634 TTGGGGAAAGCGATGGAGAAGGG + Intronic
1142955148 17:3516439-3516461 TTGCGGTAACAAAGGGAGAAGGG - Exonic
1143052240 17:4135748-4135770 CTGGTGGAAAGAATGGAGAAGGG - Intronic
1143634989 17:8159453-8159475 TTGGGTGAACTGATTGAGGAAGG - Exonic
1143703101 17:8676080-8676102 TTGGGGGAACTGAGGAAGGAGGG - Intergenic
1144062376 17:11594834-11594856 TTGGGGGAACTAAAGAAGCATGG - Intergenic
1145881203 17:28353958-28353980 TTGGGGCAAATAATAGAGCATGG + Intronic
1146938563 17:36827431-36827453 TTGAGGGAGCTGATGTAGAAGGG - Intergenic
1147286667 17:39407961-39407983 CTGGGGAAAGTAGTGGAGAAGGG - Exonic
1147690527 17:42312193-42312215 TTTGGGGAAATGATGGAGATGGG + Intergenic
1155532586 18:26782170-26782192 TTGGGGGAAGTCAAGCAGAAGGG + Intergenic
1157911259 18:51619246-51619268 TTGGGGGAACTGCTGGACACTGG + Intergenic
1158125653 18:54097177-54097199 TAGGGTCAACTAATGCAGAATGG - Intergenic
1158825009 18:61208810-61208832 TTGTGGGAACTAATTTATAAAGG + Intergenic
1159696800 18:71569013-71569035 TTGGGTGAACTGATGGTGAATGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1162806787 19:13141431-13141453 TTGGGGGGGCTAAGGCAGAATGG - Intergenic
1168720348 19:58551362-58551384 TTGGGAGAGGTGATGGAGAAGGG + Intergenic
925252178 2:2448955-2448977 TCGTGGGAACTAATGGAGGGGGG + Intergenic
927246938 2:20964479-20964501 TTGGGGGCACAAATGAAGACAGG + Intergenic
927740267 2:25562746-25562768 TTGGGGGAAAAAATGGGGAAAGG - Intronic
928576318 2:32658706-32658728 TTGGGGGATCAATTGGATAAGGG + Intronic
932945669 2:76227188-76227210 ATGGGGGAATTAATGGGGAATGG - Intergenic
935040778 2:99424891-99424913 TTGAGGGACCTAATTGAAAATGG + Intronic
936380303 2:111979174-111979196 TTGTGGAAGCTAATTGAGAATGG - Intronic
936480072 2:112877763-112877785 TTGTGGGAATTAAAGGAGATGGG - Intergenic
937310809 2:120902205-120902227 TTGGGGGAAGCAATGGGGCAAGG - Intronic
937682570 2:124659879-124659901 TTGAGGGAAGTGATGGGGAAAGG + Intronic
939264630 2:139855350-139855372 TTCGGGGATCTAATAGAAAATGG - Intergenic
939860704 2:147416806-147416828 TAGGGAGCACTAAAGGAGAAGGG - Intergenic
939887796 2:147700103-147700125 TTGGGGGGTGGAATGGAGAAAGG - Intergenic
940158485 2:150684631-150684653 TTGGGGAAGCTGAGGGAGAATGG - Intergenic
941128070 2:161610987-161611009 TTGGGAGAATAAATTGAGAAAGG + Intronic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
947579023 2:231300363-231300385 TTGTAGGAACTAATGGGGAAGGG + Intronic
947625640 2:231616511-231616533 TTGAGGGGACTGATGGAGGAGGG - Intergenic
948274949 2:236701160-236701182 TTGGGGTAACTCATGGAGGGAGG + Intergenic
1169608745 20:7354361-7354383 ATGTTGAAACTAATGGAGAAAGG + Intergenic
1171350671 20:24500375-24500397 TTGTGGAAACTCATGGAAAAAGG - Intronic
1171360613 20:24584106-24584128 CTGGGGGTTCTGATGGAGAAGGG - Intronic
1171793568 20:29549201-29549223 TTGGAGGATGGAATGGAGAAAGG - Intergenic
1171854902 20:30335186-30335208 TTGGAGGATGGAATGGAGAAAGG + Intergenic
1171972375 20:31572509-31572531 TTGGGGGCAGCATTGGAGAAGGG + Intronic
1174024716 20:47564177-47564199 TTGGGGAAAAAAACGGAGAAAGG - Intronic
1174431530 20:50473412-50473434 TTGGAGAAACTACTGGAGGAAGG + Intergenic
1174526009 20:51172077-51172099 TTGTTGGAGCTAATGGAAAATGG + Intergenic
1174822850 20:53742415-53742437 TTGGCGGAAAAAAAGGAGAAAGG - Intergenic
1174846745 20:53949954-53949976 TTGGGAGAGCTGATGGAGATTGG - Intronic
1175860351 20:62147177-62147199 TTGGGGGACCTAAAGTGGAAGGG + Intronic
1176206164 20:63889338-63889360 TTGTGGGAAGTAATGCAGAGAGG + Intronic
1176884398 21:14237040-14237062 CTGAGGGAATAAATGGAGAATGG + Intergenic
1177054662 21:16286145-16286167 TTGGGGGAAGGGATGGGGAAAGG + Intergenic
1177345077 21:19856787-19856809 TTGGGGGAAATGATGGGAAAGGG + Intergenic
1178729202 21:35083589-35083611 TTGAGGGAACTAATGAAGTGAGG - Intronic
1179337162 21:40468227-40468249 TTTGGGGATTTAAAGGAGAAAGG - Intronic
1180875742 22:19174529-19174551 TTGGGGGTACAAAGGGAGCACGG - Intergenic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1181418987 22:22784569-22784591 TTAGGAGAATCAATGGAGAAGGG - Intronic
1182103849 22:27675126-27675148 TGGGGTGAACAACTGGAGAACGG - Intergenic
1184024959 22:41848646-41848668 TTGGGGCAACTTGTGGAGCAGGG + Intronic
1184067864 22:42130469-42130491 TTGGGGGACGTCCTGGAGAAGGG - Intronic
1184306487 22:43606416-43606438 CTGGGTGAACAAATGAAGAAAGG + Intronic
949135071 3:554622-554644 CTTGGGGAACTACTGGACAATGG - Intergenic
949177020 3:1076496-1076518 TTGGGGGAAAAATGGGAGAAGGG - Intergenic
949598412 3:5572639-5572661 TTGGTGAAATGAATGGAGAAGGG + Intergenic
951469913 3:23045029-23045051 TTGGGGTAGCTAAAAGAGAAGGG + Intergenic
952350001 3:32525328-32525350 TAAGTGGAACTAATGGAAAAAGG - Intergenic
952447135 3:33392147-33392169 GTGGGGGTACTTATGGATAAGGG - Intronic
952576353 3:34778705-34778727 GTGGGGAAATAAATGGAGAAAGG + Intergenic
953296944 3:41728440-41728462 TGGTGAGAACTAATGGAGCAAGG + Intronic
955258532 3:57360252-57360274 TTGGGGGAGCCAAAGGAGTAGGG - Intronic
956931235 3:74045755-74045777 TTGGGAAAACTGTTGGAGAAGGG + Intergenic
957238618 3:77627781-77627803 TTGGTTGAAAAAATGGAGAATGG + Intronic
959513251 3:107237360-107237382 TTGAGGAAAATAAAGGAGAAAGG - Intergenic
960921434 3:122750714-122750736 TGTGGGGCACTAAAGGAGAAAGG + Intronic
960959839 3:123062473-123062495 TTGAGGGCTCTAATGGAGGAGGG + Intergenic
960968797 3:123124432-123124454 TTGGGGGAAAGAATGAGGAAGGG + Intronic
962763890 3:138543323-138543345 TTGGGGGAACCAAGGCAGTAGGG + Intronic
963108252 3:141664665-141664687 TTGGGGGAAGGAAGGGAGAGAGG - Intergenic
963618502 3:147573562-147573584 TGGGTGGGACTAATGGAGATTGG + Intergenic
963859198 3:150290359-150290381 TTGGGGGAAATAGTGGGGAAAGG + Intergenic
963910217 3:150810618-150810640 TTGGTGGAACAATAGGAGAATGG + Intergenic
965030415 3:163358417-163358439 TTGGAGGATCTAATGCAAAAGGG + Intergenic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
966629243 3:182053973-182053995 TTGGAGGATGGAATGGAGAATGG - Intergenic
966703947 3:182889902-182889924 TTGGGAGGACTAATGGAGATGGG - Intronic
969522944 4:7689341-7689363 TTGGAGGAACGGATGGAGGATGG - Intronic
969987061 4:11223358-11223380 TTGGGGCAACTGCTGGAGCAGGG + Intergenic
970227904 4:13878969-13878991 TGGGTGGAACCAATGGGGAAGGG - Intergenic
970234762 4:13947245-13947267 TTGGGGGAAAAAATGCACAAAGG + Intergenic
971940601 4:33210092-33210114 TTTGGGGACTTGATGGAGAAGGG + Intergenic
972638291 4:40903579-40903601 CAGGGGGAATTAAAGGAGAAGGG + Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
975023335 4:69518252-69518274 TTGGAGGAACTCATAGAGAGGGG - Intronic
977701922 4:100031240-100031262 TTTGGGGAACTACTGGACACTGG - Intergenic
981531870 4:145761572-145761594 TTGGTGGAATAAATGCAGAATGG + Exonic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
981897098 4:149815599-149815621 TTGTTGGAACTAAGGCAGAAAGG - Intergenic
982087453 4:151850491-151850513 TTGGGTGAAGGAATGGATAATGG - Intergenic
982515927 4:156348950-156348972 TTTAGGGAAATAATTGAGAATGG + Intergenic
982830426 4:160053310-160053332 TTGGAGGAAAGAATGTAGAATGG - Intergenic
986019508 5:3788158-3788180 TTGGAGGAGCTAATTGAGACTGG - Intergenic
987410159 5:17606835-17606857 TTGGAAGAACTGATGGAGATGGG + Intergenic
987410816 5:17613041-17613063 TTGGAAGAACTGATGGAGATGGG + Intergenic
987680569 5:21130931-21130953 TAAGGGAAACTGATGGAGAAAGG - Intergenic
991245174 5:64502892-64502914 TTTGGAGAACTAAGGGAAAAGGG - Intergenic
995134084 5:108661418-108661440 TTGGGGGAAAAAAGGGATAAAGG + Intergenic
996969473 5:129346338-129346360 GTTGGGGAAGTAATGGTGAAAGG - Intergenic
999928734 5:156407721-156407743 GTGGGGGAAATAAAGGAGGAAGG + Intronic
1000952029 5:167496212-167496234 TTCGGGGAACTAAATGAGGAAGG - Intronic
1000962935 5:167621583-167621605 TTGGGTGTAGGAATGGAGAAAGG + Intronic
1001285845 5:170423423-170423445 TTGGGGAGACAAATGGAGAGAGG - Intronic
1001321576 5:170686835-170686857 TTGAGGGAAATAAAGGAGGATGG - Intronic
1002129077 5:177068555-177068577 TTGTTGGAACTAGTGGAGAAAGG - Intronic
1003679605 6:8238995-8239017 GTGGGGGAGATGATGGAGAAAGG + Intergenic
1005039240 6:21587159-21587181 TTGGGGGAACTCATAGGGATGGG - Intergenic
1005168923 6:22958691-22958713 TGGGGGAAACAAATGGAGGAAGG - Intergenic
1008940183 6:57038217-57038239 GTGGGGGAATTAATTGAGCATGG + Intergenic
1012354454 6:98296355-98296377 TTGGGAGAACTATGGGGGAAGGG - Intergenic
1013500752 6:110748785-110748807 TTGGAGGAACTCCTGGAGAGGGG - Intronic
1014916415 6:127154773-127154795 TGGTGGGGGCTAATGGAGAAAGG + Intronic
1016662283 6:146595761-146595783 CTGTGGGAAATAAAGGAGAAGGG + Intergenic
1016767822 6:147814908-147814930 ATGGGAGAAATCATGGAGAAAGG + Intergenic
1017075018 6:150609935-150609957 CTTGGGGAACTAAAGGAGAGAGG - Intronic
1017397682 6:154021700-154021722 TTGGGGGAACTATTGTAAATGGG + Intronic
1021748003 7:23763162-23763184 CTGGGGAAATTAATGGAGACAGG + Intronic
1022897164 7:34762114-34762136 TTGGGGGAACTAATGGAGAAAGG + Intronic
1023175482 7:37431747-37431769 TTTTGGGAACTAATGGACAATGG + Intronic
1024423998 7:49204640-49204662 TTGAGGGGACAAGTGGAGAAGGG - Intergenic
1026449531 7:70515387-70515409 TTCCGGGAACTATTTGAGAATGG + Intronic
1027544440 7:79509176-79509198 TTGGGGGAATAAATGAAGTAAGG - Intergenic
1028996272 7:97103934-97103956 TTGGGGGAACAAATGGTGTTTGG - Intergenic
1029226859 7:99034605-99034627 TTGGGAGAACTGAATGAGAAAGG + Intronic
1030161187 7:106510082-106510104 TTGGAGGAAATAAAGGACAATGG + Intergenic
1031837770 7:126699278-126699300 TTGAGGGAAATAATGGAAAATGG - Intronic
1031994119 7:128217290-128217312 TTGGGGGAAAAAATGGTGGAGGG + Intergenic
1032680683 7:134179805-134179827 TTGTGGAAACTCATGGACAAAGG + Intronic
1034006978 7:147483562-147483584 TCGGGGGAAGTAGTGCAGAAGGG - Intronic
1034356516 7:150454474-150454496 TTGGGCTAAGTGATGGAGAATGG + Intronic
1036991626 8:13604713-13604735 TGGGGTCAACAAATGGAGAATGG - Intergenic
1037432138 8:18824910-18824932 TTGGGGGGACTTATGGAAAGAGG - Intronic
1038672045 8:29590506-29590528 TGGGGGGAGGCAATGGAGAATGG + Intergenic
1038691207 8:29765095-29765117 TAGGGGGAACAAATGCAGGAAGG - Intergenic
1039715249 8:40101413-40101435 TTTGGGAAATTAATTGAGAAAGG - Intergenic
1041364769 8:57090591-57090613 TTGGAGGAACTAGTAAAGAAAGG + Intergenic
1041544526 8:59026952-59026974 GTGAGGGAAGCAATGGAGAAGGG + Intronic
1042433378 8:68734886-68734908 GTGGGGAAACTAATTGTGAATGG + Intronic
1043750900 8:83932594-83932616 TTGGAGGACATAATGAAGAAAGG - Intergenic
1044360322 8:91275686-91275708 TTGGGGGAATTGCTGGGGAATGG + Intronic
1044774034 8:95669157-95669179 TCGGGGGACATAATGGAAAAGGG + Intergenic
1045073693 8:98539277-98539299 TTGGGGGAAAAAAGGGAGGAAGG + Intronic
1045771293 8:105743268-105743290 TTGGGGCAACTGGTGGAGAATGG + Intronic
1046052339 8:109038841-109038863 TGGCTGGAACTTATGGAGAAAGG - Intergenic
1048199203 8:132357771-132357793 GTGGGGGATCCCATGGAGAAGGG - Intronic
1049159778 8:141089751-141089773 TTGGGGGAACTGAGAGAGAGGGG - Intergenic
1050369926 9:4910228-4910250 TTGGGAGAATTTATGGGGAATGG + Intergenic
1050530111 9:6581261-6581283 TTGGGGGCACTGAGGGAGACTGG - Intronic
1051579108 9:18651341-18651363 TTGGAGGTTCTAATGAAGAATGG - Intronic
1051857175 9:21581856-21581878 CTGAGGGAACAAAAGGAGAAAGG - Intergenic
1052648558 9:31270938-31270960 TTGGGGGAAGGAAATGAGAATGG - Intergenic
1054152452 9:61616354-61616376 TTGGAGGATGGAATGGAGAAAGG - Intergenic
1054987063 9:71274096-71274118 ATGGATGAACTAATGGATAAGGG - Intronic
1055582810 9:77725674-77725696 CTGGGGAAATTATTGGAGAAAGG + Intronic
1056495989 9:87155714-87155736 TAGGGGGAAGGAATGGAGGAGGG + Intronic
1057361636 9:94378635-94378657 TTGTGGTAACTAATGGAGCGAGG + Intronic
1057416171 9:94863998-94864020 TTGGGGGTACTGAGGAAGAAGGG + Intronic
1057648075 9:96895621-96895643 TTGGGGGAATTACTGGACATTGG + Intergenic
1057661721 9:97009538-97009560 TTGTGGTAACTAATGGAGCGAGG - Intronic
1058755491 9:108079368-108079390 TTGGGGGAAGGAAAGGAGAGAGG + Intergenic
1059163963 9:112061206-112061228 TTGGGGTACATAATGGAGCAAGG - Intronic
1059516457 9:114900463-114900485 TGGTGGGAAATAATGGAGATTGG - Intronic
1059903471 9:118954766-118954788 TGGGGGGAAGTGATGGAGGATGG + Intergenic
1061039437 9:128131389-128131411 TTCGTGGAACTAAGGGACAAAGG - Intergenic
1061769631 9:132908555-132908577 ATCGGGGAGCTGATGGAGAACGG - Intronic
1187445634 X:19358427-19358449 TAGGGGGACTTAAGGGAGAAAGG + Intronic
1188676917 X:32952615-32952637 TTGGGGAAATTAGTGGTGAATGG - Intronic
1189419700 X:40845916-40845938 AGGGGGCAACTACTGGAGAAGGG - Intergenic
1195641614 X:107181877-107181899 TTGGGAAATATAATGGAGAAAGG - Intronic
1196244489 X:113384381-113384403 CTGGTGGAGCTAATGGAGAAAGG + Intergenic
1199574578 X:149301112-149301134 TTTGGGTAAATAATGGGGAAAGG - Intergenic
1201788177 Y:17808007-17808029 TTGTGGGAAATAATCGAGGAGGG - Intergenic
1201813376 Y:18097981-18098003 TTGTGGGAAATAATCGAGGAGGG + Intergenic