ID: 1022898240

View in Genome Browser
Species Human (GRCh38)
Location 7:34774529-34774551
Sequence CAGCTGTTCCATCTTGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022898236_1022898240 2 Left 1022898236 7:34774504-34774526 CCAAATACATTTGGTGCCCCATT 0: 1
1: 0
2: 1
3: 3
4: 109
Right 1022898240 7:34774529-34774551 CAGCTGTTCCATCTTGACCAAGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022898240 Original CRISPR CAGCTGTTCCATCTTGACCA AGG Intronic
900751701 1:4401777-4401799 CAGCTCTGCCTACTTGACCATGG + Intergenic
901227802 1:7624529-7624551 CATCTCTTCCACCTTCACCAAGG - Intronic
901736497 1:11315805-11315827 CAGCTGATCCATACTGACAATGG - Intergenic
902282609 1:15385346-15385368 CAACTGTTCCATCTTTATGAAGG - Intronic
903184664 1:21622402-21622424 CAGCTGTGCCATCCTGAGCGCGG + Intronic
904058863 1:27690736-27690758 GAGCAATTCCATCTTGAACAGGG - Intergenic
906518299 1:46452486-46452508 CAGCTCTTCCCTCTGGACCATGG - Intergenic
906702792 1:47872062-47872084 CACCTGGTCCATCCTGAACATGG - Intronic
912486299 1:110031589-110031611 CAGCAACTCCATCTTGAACAGGG - Intronic
915467261 1:156104933-156104955 CATCTGTTTCCTCTTGGCCATGG - Intronic
915934133 1:160080951-160080973 CAGTTATTCCATCTGTACCAGGG - Intergenic
917598911 1:176556420-176556442 CAGGTGTTCCCTCTCAACCAAGG - Exonic
920649086 1:207823458-207823480 CAGCTGCTCAAGCCTGACCAGGG - Intergenic
920650897 1:207836674-207836696 CAGCTTTATCATCTTGGCCAAGG - Intergenic
921168962 1:212528664-212528686 CAGCTGTTCCCATCTGACCATGG + Intergenic
922364243 1:224849266-224849288 GAGCTATTCCATCTTGAGTAGGG + Intergenic
923086999 1:230709655-230709677 TGGCTGTGCCATCTTGAGCAAGG + Intronic
924807355 1:247372106-247372128 GAGCAATTCCATCTTGAACATGG - Intergenic
1063153483 10:3357116-3357138 CAGCTGTTTGATCCTGAGCAAGG - Intergenic
1063320496 10:5047304-5047326 CTGGTGTTACAGCTTGACCAAGG + Intronic
1067156756 10:43788384-43788406 CAGCAGTTCAAATTTGACCAAGG + Intergenic
1067329773 10:45304128-45304150 CACCTCTTCCATCATGCCCAAGG - Exonic
1068496625 10:57791353-57791375 CAGCTGTTCCATCAAGGGCAAGG + Intergenic
1069858187 10:71453302-71453324 CAGCTGTTTCTTCTGGACCCAGG + Intronic
1071324083 10:84494525-84494547 GAGCAATTCCATCTTGAACAGGG - Intronic
1073139976 10:101240794-101240816 CTCCTGTTCCATGCTGACCACGG + Intergenic
1074590888 10:114811932-114811954 CAGCTGTTCCATCTTTCGCTGGG - Intergenic
1074765596 10:116697628-116697650 CAGCTGTGCCATTTTGGTCAAGG - Intronic
1077720629 11:4625109-4625131 CAGCTGATCCATCAAGAGCAGGG - Intergenic
1078385619 11:10889531-10889553 CAGCTGATCCATCATGTGCAGGG + Intergenic
1083013367 11:59425351-59425373 CAGCTGATCCATCTAGTGCAGGG + Intergenic
1083547318 11:63558584-63558606 CAGCAGTTCCTTCTTCACTATGG + Exonic
1084427441 11:69092992-69093014 AACCTCTTCCATTTTGACCATGG - Intergenic
1084438968 11:69159920-69159942 CAGCTGTTCCGGGTTGCCCAGGG + Intergenic
1084778102 11:71390482-71390504 CTGCTTTTCCATGTCGACCAGGG + Intergenic
1087194614 11:95293064-95293086 CATCTGTTCCATATTCAGCAGGG - Intergenic
1087870632 11:103289023-103289045 CAGCTGATCCATCTAGTGCAGGG - Intronic
1092455196 12:8636825-8636847 CAGCAGCTGCATCTTGTCCATGG - Intergenic
1092652890 12:10653857-10653879 GAGCAGCTCCATCTTGAACAGGG + Intronic
1092881953 12:12893613-12893635 CAAATGTTCCATTTGGACCATGG + Intronic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1099061030 12:77909351-77909373 CAACTGTTCCACCCTGATCAAGG + Intronic
1100245730 12:92754679-92754701 CAGTAGTTCCATATTGACCCTGG - Intronic
1100407427 12:94283775-94283797 CAGCTGATCCATCAAGAGCAGGG + Intronic
1104644396 12:130486592-130486614 AAGCTGTGCCATCTCGGCCAAGG + Intronic
1104858257 12:131911943-131911965 CAGCTGCTGCATCTCGCCCAGGG - Exonic
1106029510 13:25987426-25987448 CAGCTGTTCCACCTGGAAGATGG + Intronic
1106542322 13:30700989-30701011 CAGCTGATCCATCCAGAGCAGGG - Intergenic
1108739764 13:53323595-53323617 CACATTTTCCATCTTGTCCAGGG - Intergenic
1110010027 13:70320795-70320817 GAGCAGCTCCATCTTGAACAGGG - Intergenic
1110396914 13:75040826-75040848 GAGCAATTCCATCTTGAACAAGG - Intergenic
1110571898 13:77013499-77013521 CAGCTGATCCATCTAGTGCAGGG - Intronic
1110911940 13:80976519-80976541 CAGCTGATCCATCAGGACCCAGG - Intergenic
1115513604 14:34162863-34162885 CAAATGTTCCATTCTGACCAGGG + Intronic
1116688402 14:48073051-48073073 CTGCTCTTCCATCTTGTCCTAGG - Intergenic
1118639121 14:67776026-67776048 CAGCTGCTCCAGCATGAACAGGG + Exonic
1120583442 14:86282159-86282181 CAGATGTTCCAGTTTGTCCAAGG - Intergenic
1120961944 14:90132966-90132988 CAGCTGTTCCAACGTGAAAATGG - Intronic
1120975774 14:90246996-90247018 CAGCTCTTCCATACTGCCCAAGG - Intergenic
1123899046 15:24858027-24858049 CAGCTGATCCATCGGGAGCAGGG + Intronic
1125430470 15:39588543-39588565 CAGATGTCCCATGGTGACCAAGG - Exonic
1127870910 15:63072943-63072965 GAGCTGCTCCATCTTTAACATGG + Intergenic
1127939023 15:63674647-63674669 CAGCTGTCCTATCTTTACCTCGG - Exonic
1129213572 15:74086347-74086369 CAGCGGTTTCATTTAGACCACGG - Intergenic
1129400440 15:75279016-75279038 CAGCGGTTTCATTTAGACCACGG + Intronic
1129730708 15:77930670-77930692 CAGCGGTTTCATTTAGACCACGG - Intergenic
1130074835 15:80679695-80679717 GAGCAGCTCCATCTTGAACAGGG - Intronic
1130084927 15:80770016-80770038 CAGCGACTCCATCTTGAACAGGG - Intergenic
1130837160 15:87662666-87662688 CAGCTGATCCATCTAGTGCAGGG - Intergenic
1131908912 15:97174395-97174417 CTGCTGTTCCTTCTTGAATAAGG - Intergenic
1133309277 16:4832888-4832910 CAGCTGTTCCACTTTGATCCAGG + Exonic
1133490261 16:6261325-6261347 CAGTTTTTCCATCTTGAGGAAGG + Intronic
1139102454 16:63785155-63785177 AAGCTGTTCCATGTGGAGCAGGG + Intergenic
1141510876 16:84511298-84511320 CATCTGTTCCATCTTTACCTGGG - Intronic
1142896541 17:2982814-2982836 CTGCTCTTCCATTATGACCAAGG - Intronic
1144241760 17:13319644-13319666 CAACTTTTCCATTTTGACCTGGG - Intergenic
1144555162 17:16275528-16275550 CAGCAATTCCATCTTGAATAGGG - Intronic
1144685202 17:17221541-17221563 GAGCTTCTCCATCTGGACCAAGG + Exonic
1146327550 17:31899949-31899971 CAGTTTTACCATGTTGACCAGGG - Intronic
1147925844 17:43945275-43945297 CAGCGACTCCATCTTGAACAAGG + Intergenic
1148235744 17:45967900-45967922 CAGCTTGTCCATCATGACCCTGG + Intronic
1149213180 17:54326696-54326718 CAGCAACTCCATCTTGAACAGGG - Intergenic
1150348606 17:64423993-64424015 CAGCTGATCCATCAGGAGCAGGG - Intergenic
1152190758 17:78885908-78885930 CAGCTGTGCCAAGGTGACCAAGG + Intronic
1152556897 17:81057914-81057936 CAGCTCCCCCATCTTCACCAGGG - Exonic
1154001516 18:10485949-10485971 CACCTGATCCATTTTGAGCAGGG - Intronic
1155903909 18:31426252-31426274 CAGGTCTTCCATCCTGTCCAAGG - Intergenic
1157066562 18:44357047-44357069 CAGCAGTCCCAGCTTGACCTGGG - Intergenic
1159235617 18:65669149-65669171 CAAGTTTTCCATCTTGGCCATGG - Intergenic
1159366466 18:67472067-67472089 CAGCTCTTCCATGTTAACCACGG + Intergenic
1161523494 19:4738875-4738897 CAGCTGATGCTTGTTGACCAAGG - Intergenic
1161719399 19:5894778-5894800 CAGCCGGCCCATCTTGACCAGGG + Intronic
1163782565 19:19258108-19258130 CAGCTGCCCCACCTTGGCCACGG + Exonic
1165761085 19:38321422-38321444 CACCTGTTCCCTCTGGACCTGGG + Intronic
927813675 2:26195185-26195207 CAGCAGCTGCATCTTGTCCACGG + Exonic
929798955 2:45083052-45083074 CAGTTGTTCCATCTGGAAAATGG + Intergenic
930839340 2:55827669-55827691 CAGCTGATCCATCTAGTACAGGG + Intergenic
935064742 2:99637889-99637911 TAGCTGTCCCTTCTAGACCAAGG - Intronic
937284215 2:120739655-120739677 CAGCTGTTCCCGCTGGGCCAGGG + Intronic
940175693 2:150875377-150875399 CAACTTTTCAATCTTTACCAAGG + Intergenic
941304791 2:163850295-163850317 GAGCAATTCCATCTTGAACAGGG - Intergenic
941877384 2:170447959-170447981 CAGCTGATCCATCGAGTCCAGGG + Intronic
942561134 2:177220236-177220258 CAGCAGTTCAAATTTGACCAAGG - Intronic
942700206 2:178699309-178699331 CAGCTGTTATACCTTAACCACGG + Intronic
942877848 2:180823886-180823908 CAGCTGCTCCATCTTCCCCTAGG + Intergenic
943353685 2:186824300-186824322 CAGGTGTCCCATCTCCACCAGGG - Intergenic
943808327 2:192151923-192151945 CAGATGTTCCATGTTGGCTAAGG + Intronic
945908277 2:215618284-215618306 GAGCACTTCCATCTTGAACAGGG - Intergenic
946868278 2:224061784-224061806 CAGCTACTCAATCTTGCCCAAGG - Intergenic
948140685 2:235670200-235670222 CAGCTGCTCCTTCCTGACCATGG - Intronic
948375055 2:237515795-237515817 CAGCTGGTCCAGCTTCATCACGG - Intronic
1179287090 21:39986810-39986832 CAGCTCTTCCTTCTTCAACATGG + Intergenic
1180883945 22:19226441-19226463 CAGCTGCTCAATCTTGCCCCAGG + Intronic
1183618560 22:38959643-38959665 GTGCTGGTCCATCTTGACCGAGG - Exonic
952587701 3:34912545-34912567 TAGCTGTTACATCATGAACAGGG - Intergenic
955070928 3:55571990-55572012 CAGGTGTTCCCTCTAGACCCAGG + Intronic
955853017 3:63241316-63241338 CAGCTATTTCCTCTTTACCAAGG + Intronic
956008516 3:64805710-64805732 CAGCTGATGCTTCTTGTCCAGGG - Intergenic
963269742 3:143274019-143274041 CAGTTGTTGCATCTTGTCTAAGG + Intronic
967521411 3:190436952-190436974 CCGATGTTCCATCTTGTCCCAGG - Intronic
967541005 3:190667786-190667808 CAGCAGTAACAGCTTGACCATGG - Intergenic
968487933 4:872879-872901 CAGCTGTTACATCTGTGCCATGG + Intronic
969319818 4:6404909-6404931 CCACTGTGCCATCTTGAGCAAGG + Intronic
971127655 4:23771823-23771845 CAGGTGTTTCATCTTCAGCAGGG - Intronic
971494652 4:27251006-27251028 CATCTGTCCCATCCAGACCAAGG - Intergenic
974183095 4:58408942-58408964 CAGCTTTTCCATCCCAACCAAGG + Intergenic
975695072 4:77004601-77004623 CTAGTGTTCCATCTTGAACATGG + Intronic
976154735 4:82130485-82130507 CAGCAGTTCAAATTTGACCAAGG - Intergenic
977712660 4:100145535-100145557 CAGCTGGGCCCACTTGACCAAGG - Intergenic
980080032 4:128334444-128334466 CATCTGTTCCATCATGATAAGGG - Intergenic
982008822 4:151087513-151087535 CAGCTGATCCATCAAGAGCAGGG - Intergenic
983434586 4:167696372-167696394 GATCTGTTCCATCCTGACCTGGG + Intergenic
983942080 4:173544763-173544785 CATCTCTTCCATCTTTACAATGG - Intergenic
986010273 5:3707893-3707915 CAACATTTCCATCTTGACTAAGG + Intergenic
987296626 5:16558324-16558346 CTGCCCTTCCATCTTCACCATGG + Intronic
987925670 5:24337664-24337686 CAGCTGCTCCATCTTTGCCTAGG - Intergenic
991215229 5:64152215-64152237 GAGCTGTTACAACTTCACCATGG + Intergenic
992085586 5:73275346-73275368 CAGCTGTTCCATTTTCTCCAAGG - Intergenic
992665489 5:79004465-79004487 CAGCTGTTCCACAATGAACAGGG - Intronic
993180986 5:84551396-84551418 CAGCTGTTCCATTTTTACTTTGG + Intergenic
995481628 5:112598949-112598971 CTTCTGTGCCATCTTGAACAAGG + Intergenic
995645258 5:114304515-114304537 CAAGTGCTTCATCTTGACCAGGG + Intergenic
998328797 5:141305246-141305268 CAGCAACTCCATCTTGACTAGGG + Intergenic
1000437493 5:161230911-161230933 CAGTTTTTCCATCTTTACAAGGG + Intergenic
1000450174 5:161375979-161376001 GAGATGTTTCATCTTGACTATGG - Intronic
1000546060 5:162604276-162604298 CAGTGGTTCCACCTTGGCCATGG - Intergenic
1000733100 5:164860951-164860973 CACAAGTTCCATCTTGACTATGG - Intergenic
1002302167 5:178263297-178263319 CAGCAGCTCCATCTTGTCCTTGG + Exonic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002979027 6:2115980-2116002 CAGCATTTCCATTTTGACCCTGG - Intronic
1005218821 6:23562805-23562827 CAGCTGATCCATCAAGTCCAGGG + Intergenic
1007241763 6:40431752-40431774 CAGCTGGTACATCTTCACCCGGG + Exonic
1007512939 6:42388459-42388481 CAGCTGTACCAACTTGACTGTGG - Intronic
1007598417 6:43066310-43066332 CTGCTGTAGCACCTTGACCACGG - Exonic
1011952715 6:92986809-92986831 CAACTGTTTCATCTTGCTCAGGG - Intergenic
1013089615 6:106888333-106888355 CAGCTGATCCATCATGTGCAGGG - Intergenic
1013471663 6:110471975-110471997 CACCTGATCCATATTGACAAGGG + Intronic
1014075051 6:117225955-117225977 CAGGTGCTCCATCTCTACCAGGG + Intergenic
1014787517 6:125635308-125635330 CAGCTGCTTCATCTTTATCAAGG + Intergenic
1015132385 6:129827899-129827921 AAGCTGTTCAATCTTCACCATGG - Intergenic
1018429603 6:163713048-163713070 TGGCTGCTCCATCTTGGCCACGG + Intergenic
1019557343 7:1639268-1639290 CAGGTGCTCCATCTTGAATAAGG - Intergenic
1019980931 7:4621476-4621498 CTGTTGTTCCCCCTTGACCACGG + Intergenic
1021505115 7:21374175-21374197 CAGTTGTTCCCTCTTATCCATGG - Intergenic
1021700325 7:23313402-23313424 AAGCAGGACCATCTTGACCAAGG - Intronic
1021732449 7:23609042-23609064 CAGCTGATCCATCTAGTTCAGGG + Intronic
1022898240 7:34774529-34774551 CAGCTGTTCCATCTTGACCAAGG + Intronic
1023049481 7:36238387-36238409 CAGCTATTCCATCTTGAATAGGG - Intronic
1023087494 7:36586036-36586058 CAGATGGTCCGTCTTGCCCAAGG + Intronic
1023932461 7:44714239-44714261 CAGCTGATCCATCTAGTGCAGGG - Intergenic
1024315872 7:48016098-48016120 CAGCTGATCCATCTAGTGCAGGG - Intronic
1024423256 7:49194830-49194852 CAGCTGTGCCATCATGATCCTGG - Intergenic
1025005388 7:55350400-55350422 CAGCGACTCCATCTTGAACAGGG + Intergenic
1026327998 7:69327589-69327611 CAGCTGTTCCAGCTGGAGGATGG + Intergenic
1026494663 7:70892094-70892116 CAGCTGATCCATCAAGTCCATGG - Intergenic
1027724900 7:81791743-81791765 CTGCTCATCCAACTTGACCATGG - Intergenic
1028784734 7:94779513-94779535 CAGCTGTTCTAGCTTTTCCAGGG + Intergenic
1029227645 7:99039701-99039723 CACATGTTCCAACTTGAACAGGG - Intronic
1032583577 7:133126376-133126398 CAGCTGTTGTATCTTTACTAAGG + Intergenic
1036459151 8:8936519-8936541 GAGCTGTGCCACCTTGAACATGG + Intergenic
1038644321 8:29350258-29350280 CAGCTCCTCCATCGTCACCATGG + Exonic
1045555996 8:103215081-103215103 AAGCTGCTTCCTCTTGACCACGG - Intronic
1048259762 8:132935827-132935849 CAGCTGGAGAATCTTGACCATGG - Exonic
1048821759 8:138386755-138386777 CAGCGGTCTCATCATGACCAGGG - Intronic
1049222208 8:141433290-141433312 CAGCTGTTCCATCTGTAAAATGG - Intergenic
1049284670 8:141768063-141768085 CAGCTGTTCCTTCTGGGGCAGGG - Intergenic
1050959167 9:11705633-11705655 CAGCTATTCCATCTTGAATAGGG + Intergenic
1051104247 9:13560140-13560162 CAGCTGTTCCATCTTGTCTGGGG - Intergenic
1051433706 9:17007592-17007614 CAAGTGTTTCATCTTTACCAGGG - Intergenic
1052250756 9:26394356-26394378 GAGCAGGTCCATCTTTACCATGG - Intergenic
1056528601 9:87467330-87467352 CAGCAACTCCATCTTGACTAGGG + Intergenic
1057725095 9:97562787-97562809 CAGCAGCTCCATCATGAACAAGG + Exonic
1058783235 9:108360535-108360557 CAGGTATTCTATCTTGAACAGGG + Intergenic
1060491040 9:124084586-124084608 CTGCTGGTCTATCTTGACCTGGG - Intergenic
1060795090 9:126507797-126507819 CAGCTGTTCTATCTGCACCACGG - Intergenic
1061289060 9:129640599-129640621 CAGCTCAGCCATCTTGAGCAGGG + Exonic
1061619532 9:131802679-131802701 CAGCTTTTCCATCTTCAAAAGGG + Intergenic
1062606072 9:137349418-137349440 CAGCTGCTGCGTCTTGTCCAGGG + Exonic
1203786282 EBV:129656-129678 CAGCTCCTCCATCTTGACCGTGG + Intergenic
1186960381 X:14730269-14730291 CAGCTGTTCCATCTTTCACTTGG - Exonic
1187112316 X:16314345-16314367 CAGCTGATCCATCTAGTGCAGGG + Intergenic
1189688586 X:43591771-43591793 CACGTGTTTCATCTTGACCAAGG + Intergenic
1196814082 X:119651305-119651327 CTGCTGTTTCATCTTGGCAAGGG - Intronic
1197541721 X:127771405-127771427 CAGCAGTTCCTTCTTGAACATGG - Intergenic
1199223636 X:145345591-145345613 CATCTGGTCCATCTTGACTGAGG - Intergenic
1201569530 Y:15399333-15399355 CAGCTGTTCCAGCTTCAGCCAGG + Intergenic