ID: 1022899324

View in Genome Browser
Species Human (GRCh38)
Location 7:34787217-34787239
Sequence CTCTGTAATATAAACATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022899324 Original CRISPR CTCTGTAATATAAACATGCA AGG (reversed) Intronic
902170970 1:14610729-14610751 CTCTGGAAAATACACCTGCATGG + Intronic
904966161 1:34375390-34375412 TTCTGTGATATAAACTTGGACGG + Intergenic
905678054 1:39843771-39843793 CACTGAATTATAAACATGAAAGG + Intronic
907858812 1:58330370-58330392 CTCTATAACATAAATGTGCAAGG + Intronic
908091726 1:60692983-60693005 TTCTATAACATAAAAATGCAAGG + Intergenic
908670152 1:66537289-66537311 TTCTGTAGTATAAATATGAAAGG + Intronic
908689610 1:66763614-66763636 CTCTGTAACATAAAAGTGCAAGG - Intronic
908839437 1:68263774-68263796 CTCTGTGATTTAAACAAACAAGG + Intergenic
908849608 1:68362368-68362390 CTCTATAACATAAAAGTGCAAGG - Intergenic
908921913 1:69205098-69205120 CTCTATAACATAAAAGTGCAAGG - Intergenic
909029109 1:70517841-70517863 CACTGTAACATAAAAGTGCAAGG + Intergenic
909353346 1:74678956-74678978 TTCTGTAATCTGAACATGAATGG + Intergenic
909728314 1:78863293-78863315 CTCTCCAATAAAAACATTCAGGG - Intergenic
910068083 1:83177888-83177910 ATCTGTAATATAAAAGTGCAAGG - Intergenic
910298150 1:85673817-85673839 CTCTGTAACATACTCATGAATGG - Intronic
910732732 1:90415865-90415887 CTCTATAACATAAAAGTGCAAGG + Intergenic
911474101 1:98354964-98354986 CTCTGTGATATAAAGAAGTATGG - Intergenic
911513281 1:98834865-98834887 CTCCATAATATAAAAGTGCAAGG - Intergenic
911548258 1:99247207-99247229 TTCTGTAATATAATCATGTGTGG - Intergenic
912205792 1:107507987-107508009 TTCTGTAACATAAAAGTGCAAGG + Intergenic
912322912 1:108731175-108731197 CTATGTCATATAAAGATACATGG - Intronic
912731432 1:112109856-112109878 CTCTATAACATAAAAGTGCAAGG - Intergenic
912902470 1:113667368-113667390 CTCTATAATATAAAACTGCAAGG - Intronic
916191532 1:162183642-162183664 CTCTGTAACATAAAAATGGAAGG - Intronic
916314042 1:163427760-163427782 CTCTGTGATATCAGCATGAAGGG - Intergenic
917950937 1:180035250-180035272 CTCTATAAAATAAAAGTGCAAGG + Intronic
918138741 1:181702084-181702106 ATCTTTAATATAAACATGTCAGG + Intronic
918498317 1:185164590-185164612 CTCTGTAACATAAAAGTACAAGG - Intronic
919054960 1:192559126-192559148 CTCTATAACATAAAAGTGCAAGG - Intergenic
919115421 1:193275551-193275573 CTCTGTAATATGACAAAGCAAGG - Intergenic
919200044 1:194344585-194344607 ATCCATAACATAAACATGCAAGG - Intergenic
919282093 1:195503446-195503468 CTCTGTAACATAAAAGTGCAAGG - Intergenic
919308415 1:195874581-195874603 CTCTATAACATAAAAGTGCAAGG - Intergenic
919328363 1:196137623-196137645 CTCTGTAATATGCAAATGCAGGG + Intergenic
919548857 1:198959349-198959371 CTCTATAATACAAAAGTGCAAGG - Intergenic
920614919 1:207482401-207482423 CTATCTAGTATATACATGCATGG + Intronic
921301738 1:213757572-213757594 CTCCATAATATAAAAATTCAAGG + Intergenic
921313951 1:213873109-213873131 CACTGTAACATAAAAGTGCAAGG + Intergenic
922549124 1:226481229-226481251 CTCTGAAATATGAACAGTCAAGG - Intergenic
922624144 1:227020486-227020508 CTCCATAACATAAAAATGCAAGG - Intronic
922823362 1:228500242-228500264 CACTGTAACATAAAAATGCAAGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1062865997 10:854969-854991 CTCCATAACATAAAAATGCAAGG - Intronic
1063801979 10:9590219-9590241 CTCTATAACATAAAAGTGCAAGG - Intergenic
1063824958 10:9885880-9885902 CTCTATAACATAAAAGTGCAAGG - Intergenic
1063839060 10:10049192-10049214 CCCTGAAATAGAAACATGCTTGG + Intergenic
1064788335 10:18925109-18925131 CTCTGTAACATAGAAATGTAAGG - Intergenic
1065439564 10:25737156-25737178 GTCTGTAACATAAAAGTGCAAGG + Intergenic
1067094207 10:43287544-43287566 CACTGTAATTTAAACACCCAAGG + Intergenic
1067301815 10:45018507-45018529 CTCTATAACATAAAAGTGCAAGG - Intergenic
1068242995 10:54328949-54328971 CTATGTTATATAAGCATGTAAGG + Intronic
1068319353 10:55391218-55391240 CTCTGTAACATAAAAATTCAAGG - Intronic
1069275852 10:66589481-66589503 CTCTTTACTATAAACACCCATGG + Intronic
1070360874 10:75687559-75687581 CTCTGTAACATGAAAGTGCAAGG + Intronic
1071971221 10:90909180-90909202 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1072517857 10:96203884-96203906 CTCTGTGAAATAAACATTCTTGG + Intronic
1073696263 10:105872275-105872297 CTCTACAACATAAAAATGCAAGG - Intergenic
1074725559 10:116304918-116304940 CTCTGTAAAATAAAAGTGCAAGG - Intergenic
1074905222 10:117856324-117856346 CTCCATAATATAAAAGTGCAAGG - Intergenic
1075010159 10:118861152-118861174 CTCCGTAATATAAAAGTACAAGG + Intergenic
1075155219 10:119970426-119970448 CTCTGTAAGATAAACACTCAGGG - Intergenic
1075431779 10:122390088-122390110 CTCTATAACATAAAAGTGCAAGG - Intronic
1075691956 10:124402766-124402788 ATCTGTAATAAAAACATTTAAGG - Intronic
1076212642 10:128660720-128660742 GTCTCCAATATAAACATGAATGG + Intergenic
1076544425 10:131235307-131235329 CTCTAGAAAATGAACATGCAGGG + Intronic
1076808281 10:132870750-132870772 CTCTGTCACATAAAAATGCCAGG + Intronic
1078800243 11:14636455-14636477 CTCAGGAATACAAACATGTAAGG - Intronic
1079020045 11:16902517-16902539 CTTTTTAATATAAACATCCTAGG + Intronic
1079303635 11:19302927-19302949 CTCCGTAACATAAAAGTGCAAGG - Intergenic
1079533339 11:21481620-21481642 CTCTGACAAGTAAACATGCAGGG - Intronic
1080358951 11:31490560-31490582 CTCTCTAATATAAACATTAAAGG + Intronic
1080527519 11:33141007-33141029 CTCTTTAAAATATACATGCCTGG + Intronic
1081349994 11:42039756-42039778 CTCTGCATTTTAAAGATGCAGGG - Intergenic
1082264408 11:50104080-50104102 CTCTTTCATATGAACATGAAGGG - Intergenic
1084668211 11:70588688-70588710 TTCTGTAACGTAAACACGCAAGG + Intronic
1085367127 11:75959394-75959416 CTCTAGAACATAGACATGCAAGG - Intronic
1086034501 11:82400319-82400341 CTCTATAACATAAACGTACAAGG - Intergenic
1086471565 11:87118778-87118800 CTCCATAACATAAAAATGCAAGG - Intronic
1086848868 11:91784834-91784856 CTCTGTTATAGAGACATGCAAGG + Intergenic
1087494079 11:98866995-98867017 CTCTGTAACCTAAACACCCAGGG - Intergenic
1088439633 11:109855482-109855504 CTCTGTAACTTAAAAGTGCAAGG - Intergenic
1090260785 11:125318032-125318054 CTCTATAACATAAAAGTGCAAGG - Intronic
1093690863 12:22107230-22107252 CTTTATAACATAAAGATGCAAGG - Intronic
1093889363 12:24501093-24501115 CTCTTTGATAAAAACAAGCAAGG + Intergenic
1095208693 12:39468035-39468057 CTCTATAATGTAAAAGTGCAAGG + Intergenic
1095308449 12:40665215-40665237 CTCCATAATATAAAAGTGCAAGG + Intergenic
1097328535 12:58307087-58307109 CTCTATAACATAAAAGTGCAAGG + Intergenic
1097363789 12:58688377-58688399 CTCTATAACATAAACAATCAAGG - Intronic
1097788519 12:63788518-63788540 CTCCATAACATAAAAATGCAAGG - Intronic
1098319325 12:69225415-69225437 TTCCGTAATATAAAGATACAAGG - Intergenic
1098344484 12:69486948-69486970 CTATGTAACATAAAAGTGCAAGG + Intronic
1098936764 12:76489184-76489206 CTCTATAACATCAAAATGCAAGG + Intronic
1099474208 12:83088110-83088132 CTCTATAATATAAAAATGCCAGG - Intronic
1100516390 12:95332269-95332291 CTCTGTAATATAAAGGTGCAAGG - Intergenic
1102654094 12:114465753-114465775 CTCTATAATGTAAAAATGCTAGG + Intergenic
1104231530 12:126889224-126889246 CTTTGTGACATAAACATCCAAGG - Intergenic
1104871365 12:132000109-132000131 CTCATTAATATAAACATTTAAGG + Intronic
1105337672 13:19488537-19488559 CTCTATAACATAAAAGTGCAAGG - Intronic
1105393086 13:20000307-20000329 CTCCATAACATAAACGTGCAAGG + Intronic
1105408261 13:20149574-20149596 CTACATAATATATACATGCAAGG + Intronic
1106082694 13:26513629-26513651 CTCTGTAATTTAAGGTTGCATGG - Intergenic
1106629485 13:31455706-31455728 CTCTGAAAAATAAAGAAGCAAGG + Intergenic
1108003528 13:45925727-45925749 GTCTGTATTATAAACATGAATGG + Intergenic
1108518645 13:51224772-51224794 CTCTGTTATCTACAAATGCAAGG + Intronic
1108909224 13:55522003-55522025 CTGTATAATATAAAAGTGCAAGG - Intergenic
1108916695 13:55622842-55622864 CTCTATAACACAAAAATGCAAGG + Intergenic
1109056645 13:57558286-57558308 CTCTGTAAAATAAACATGCCAGG - Intergenic
1109265807 13:60198986-60199008 CTCCGTAATATAAAAGTGCAAGG - Intergenic
1110737560 13:78955301-78955323 CTCTATAACATAAAAGTGCAAGG - Intergenic
1111163645 13:84428142-84428164 CTCCATAACATAAAAATGCAAGG + Intergenic
1111787357 13:92806174-92806196 CTCCGTAACATAAAAGTGCAAGG - Intronic
1112244195 13:97714562-97714584 CTCTGTAATAAGAAGATACAGGG - Intergenic
1112555916 13:100468541-100468563 CTCCATAATATAAAAGTGCAAGG - Intronic
1113045053 13:106146585-106146607 CACTGCAAAATAAAAATGCAGGG + Intergenic
1113722639 13:112571822-112571844 CTCCATAACATAAAAATGCAAGG - Intronic
1114042938 14:18695476-18695498 CTCTATAATATGAAAATGCAAGG - Intergenic
1114047230 14:18885916-18885938 CTCTATAATATGAAAATGCAAGG - Intergenic
1114116985 14:19633481-19633503 CTCTATAATATGAAAATGCAAGG + Intergenic
1114625584 14:24127483-24127505 CTCCATAACATAAAAATGCAAGG - Intronic
1115188336 14:30718304-30718326 CTCTGTCATAAACACATGGATGG + Intronic
1115590651 14:34861403-34861425 TTCTGTAGTATACAAATGCAGGG - Intronic
1116154205 14:41183146-41183168 TTCTGGAATATATAAATGCAGGG - Intergenic
1116261517 14:42634310-42634332 CTGTGTAATATAAATATGGGAGG - Intergenic
1116277290 14:42851801-42851823 CTCTATAACATAAAAGTGCAAGG - Intergenic
1117263389 14:54060266-54060288 CTCCGTAACATAAAAGTGCAAGG - Intergenic
1118037847 14:61887634-61887656 CTCCATAATATAAAAGTGCAAGG - Intergenic
1118112688 14:62739778-62739800 CTTTGTCATATAAACCTGCAGGG + Intronic
1118176664 14:63447368-63447390 CTCTCTAACATAAAAGTGCAAGG - Intronic
1118527063 14:66657320-66657342 CTCTGTAACATAAAAGTACAAGG + Intronic
1118560471 14:67074893-67074915 CTCCATAATATAACAATGCAAGG + Intronic
1119262067 14:73243794-73243816 CTCTCTCATATAAACACCCAGGG + Intronic
1119883320 14:78119426-78119448 CTCTGTAACATAAAAGTGCAAGG - Intergenic
1120106680 14:80503644-80503666 CCTTCTAATATAAACAAGCATGG - Intronic
1120118850 14:80653396-80653418 CTCTATAATACAAAAATGCAAGG + Intronic
1120544162 14:85789862-85789884 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1122734114 14:103825709-103825731 CTCTGTATCATAAAAGTGCAAGG + Intronic
1123764042 15:23457013-23457035 CTCTTTCCTATGAACATGCAGGG - Intergenic
1124097306 15:26660565-26660587 CTCTGTATGATAAACAGGCCTGG - Intronic
1124430144 15:29600160-29600182 CTTTGTAATCTGAGCATGCATGG + Intergenic
1124461069 15:29892326-29892348 CTCCGTAACATAAAAGTGCAAGG + Intronic
1127447079 15:59074464-59074486 CTCTATAAGATAAAAGTGCAAGG - Intronic
1127702352 15:61513731-61513753 CTGTGTATTATATGCATGCAAGG - Intergenic
1130449288 15:84034613-84034635 TTCTGTAAAATAAAGATGCTTGG + Intronic
1131909848 15:97186465-97186487 CTCCATAATATGAAAATGCAAGG - Intergenic
1132420890 15:101667550-101667572 CTCCATAATATAAAAGTGCAAGG - Intronic
1133092985 16:3419370-3419392 CTCCATAATATAAAAGTGCAAGG - Intronic
1133445408 16:5856660-5856682 CTCTATAACATAAAAATGCAAGG - Intergenic
1135327318 16:21534958-21534980 CGGTGTCATATAAAAATGCAGGG - Intergenic
1136337669 16:29620981-29621003 CGGTGTCATATAAAAATGCAGGG - Intergenic
1137234088 16:46598885-46598907 TTCTGTAACATAAAAGTGCAAGG - Intronic
1137462155 16:48674738-48674760 CTCCATAATATAAAAGTGCAGGG + Intergenic
1139560965 16:67741963-67741985 TTTTGTAATCTAAAAATGCAGGG + Intronic
1142040427 16:87890129-87890151 CGGTGTCATATAAAAATGCAGGG - Intronic
1144530748 17:16036623-16036645 CTCTGTAACATAAAAGTGCAAGG - Intronic
1145717526 17:27036191-27036213 CTCTATAATATAAAAGTGCAAGG - Intergenic
1145967257 17:28928520-28928542 CTCTGTATTATAAAAATACAAGG - Intronic
1146042935 17:29474037-29474059 CTCCGTAAAATAAAAATGCAAGG - Intronic
1146154218 17:30506565-30506587 CTCTATAATATAGAAGTGCAAGG + Intronic
1146389403 17:32407626-32407648 ATCAATAATATAAACATGGAGGG + Intergenic
1147231170 17:39019187-39019209 CTCTGTAACATAAAGGTGTAAGG + Intergenic
1148037170 17:44673955-44673977 ATCTGTAAAATAAACATTCAGGG - Exonic
1149072880 17:52563948-52563970 TTCTGTAATAGGAAGATGCATGG - Intergenic
1149377326 17:56058393-56058415 CTTTGTAACATAAAAGTGCAAGG - Intergenic
1149809320 17:59652972-59652994 CTCTATAACATAAAAGTGCAAGG - Intronic
1150509308 17:65732681-65732703 CTCCATAACATAAAAATGCAAGG - Intronic
1151949301 17:77340834-77340856 CTCTATAATGTAAAAGTGCAAGG - Intronic
1152972008 18:171106-171128 CTCTGTAACATAAAAGTGCAAGG + Intronic
1153207088 18:2715418-2715440 TTCTGTAATAAAAAAATTCATGG - Intronic
1153853753 18:9124159-9124181 CTATGTAATTTTAACATTCAAGG - Intronic
1156168420 18:34452511-34452533 CTCCGTAATATGAACATGAAAGG - Intergenic
1157960434 18:52147845-52147867 CTCCATAATATAAAAGTGCAAGG - Intergenic
1159821117 18:73145304-73145326 TTCTGTAATATAAACTTTGAAGG + Intergenic
1164490155 19:28703402-28703424 CTCTGTAACATAAAAGTGCAAGG - Intergenic
1165125066 19:33588738-33588760 CTCCATAATATAAAAGTGCAAGG + Intergenic
1166392346 19:42416034-42416056 CTCTGTAACATAAAAGTGCAGGG + Intronic
1166639778 19:44486228-44486250 CTATAAAATATAAATATGCACGG + Intronic
1168652965 19:58104793-58104815 CTCCGTAACATAAAAGTGCAAGG + Intronic
925215494 2:2091795-2091817 CTCTGTAACATAAAAGTGCAAGG - Intronic
925562225 2:5209300-5209322 CTCTATAAAATAAACATGCAAGG + Intergenic
926636055 2:15181093-15181115 CTCTGTATTCTAAACTTGCTTGG + Intronic
926643185 2:15259605-15259627 CTTTGCAATATAAACACTCAAGG + Intronic
926722226 2:15969385-15969407 CTCCGTAACATAAACGTGCAAGG - Intergenic
926895334 2:17681097-17681119 CTTTGTAATATAAAAGTGCAAGG - Intronic
927755462 2:25705026-25705048 CTCTATAACATAAAAGTGCAAGG + Intergenic
928603461 2:32923357-32923379 CTCTGCCAAATAACCATGCATGG + Intergenic
929116719 2:38450933-38450955 CTCAGTAATAAAAATCTGCAAGG + Intergenic
929338125 2:40777193-40777215 CTCTATAATATAAACGTGCATGG - Intergenic
929939136 2:46317832-46317854 CTCCATAACATAAAAATGCAAGG - Intronic
931583526 2:63803260-63803282 CTGTGTATTTTAAACATACAAGG + Intronic
932186069 2:69697237-69697259 CTCTATAACATAAAAGTGCAAGG - Intronic
932857342 2:75250111-75250133 CTCCATAATATAAAGGTGCAAGG - Intergenic
932950987 2:76293131-76293153 CTCTGTAACATAAGAGTGCAAGG - Intergenic
933075930 2:77926665-77926687 CTCCGTAATATAAAAGTGCAAGG - Intergenic
934061698 2:88300334-88300356 CTCCATAACATAAAAATGCAAGG + Intergenic
935565660 2:104604306-104604328 CTCTATAACATAAAAGTGCAAGG + Intergenic
935796870 2:106650917-106650939 CTCCATAACATAAAAATGCAAGG - Intergenic
936573192 2:113633379-113633401 CTATGTAATATAACAATTCATGG - Intronic
937516962 2:122665997-122666019 CTTTGTGATATAAACAGGCCAGG - Intergenic
938424609 2:131174458-131174480 CTCTATAATATGAAAATGCAAGG - Intronic
939653324 2:144790906-144790928 CTCTATAACATAAAAGTGCAAGG - Intergenic
940184763 2:150971681-150971703 CTCTATAACATAAAAGTGCAAGG - Intergenic
940326387 2:152429839-152429861 CTCTGTAATATGAAGGTGCTGGG + Intronic
940838807 2:158555332-158555354 TTCTTTAATATACACATGTATGG - Intronic
941386180 2:164855226-164855248 CTCTCTAACATAAAACTGCAAGG - Intergenic
942110341 2:172675662-172675684 CTCTATAACATAAAAGTGCAAGG + Intergenic
942666856 2:178328858-178328880 ATCTGTAATATACATATGGAGGG + Intronic
943123399 2:183766205-183766227 CTCTGTAACATAAAAGGGCAAGG - Intergenic
943851244 2:192725304-192725326 CTCTATAACATAAAAGTGCAAGG - Intergenic
944025943 2:195167157-195167179 CTCCATAACATAAAAATGCAAGG + Intergenic
944273997 2:197814975-197814997 CTCTATAATGTAAAATTGCAAGG + Intronic
944623266 2:201541595-201541617 CTCTGTCATATATATATGTATGG - Intronic
945652291 2:212577889-212577911 CTCCATAACATAAAAATGCAAGG - Intergenic
945690881 2:213034033-213034055 CTCTATAACATAAAAGTGCAAGG - Intronic
947812397 2:233012732-233012754 CTGTGCAATATAAAAATGCAGGG - Exonic
948298372 2:236882672-236882694 CTCTAAAATATAAACTTTCACGG - Intergenic
1169322263 20:4643102-4643124 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1170344573 20:15369543-15369565 CTTTGTAATTTAAACATACAGGG - Intronic
1173272844 20:41554289-41554311 CACTGGAATAAAAACAAGCAGGG + Intronic
1174673231 20:52328045-52328067 CTCCATAACATAAAAATGCAAGG + Intergenic
1174991351 20:55513714-55513736 CTGTATAATATAAAAGTGCAAGG - Intergenic
1175638572 20:60606636-60606658 AACAGTAAAATAAACATGCAGGG + Intergenic
1177274401 21:18889882-18889904 CTTTCTAATATACACATTCAAGG - Intergenic
1177404552 21:20647929-20647951 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1177498472 21:21919111-21919133 CTCTGAAATGCAAACATTCAGGG + Intergenic
1177687917 21:24464368-24464390 CTGTGTGATATAAGGATGCAGGG + Intergenic
1177808507 21:25899883-25899905 CTCTTTAATATAGACATAAAAGG + Intronic
1178195951 21:30345321-30345343 CTCTATAACATAAAAGTGCAAGG + Intergenic
1178519344 21:33275076-33275098 CTCCATAATATAAAAGTGCAAGG - Intronic
1179111576 21:38450742-38450764 CTCTGAAATATGAAAATGAAAGG + Intronic
1180113374 21:45677446-45677468 CTCCGTAACATAAAAGTGCAAGG + Intronic
1180465763 22:15608571-15608593 CTCTATAATATGAAAATGCAAGG - Intergenic
1182838857 22:33367799-33367821 CTTTTTAATATAAACATTTAAGG + Intronic
1184624316 22:45711455-45711477 CTCTGTAACTTAATAATGCAGGG - Intronic
1184699285 22:46159309-46159331 TTTTGTAATAGAAACAAGCAGGG + Intronic
1184844327 22:47071936-47071958 ATCTGCAATATAAAAAGGCAGGG - Intronic
1185426993 22:50777501-50777523 CTATGTAATATAACAATTCATGG + Intronic
949208442 3:1468790-1468812 CTATGAAATTTAAAAATGCAAGG - Intergenic
949626464 3:5872319-5872341 CTCTATAACATAAAAGTGCAAGG + Intergenic
950517181 3:13474940-13474962 CTCTGTAACAACAAAATGCAGGG + Intergenic
950976262 3:17248940-17248962 CTCTGTAACATTAAAGTGCAAGG - Intronic
951306666 3:21071681-21071703 CTCTATAACATAAAAGTGCAAGG + Intergenic
951346628 3:21554764-21554786 CTCCATAACATAAACGTGCACGG - Intronic
951513603 3:23532578-23532600 CACTGTAATATTAACAGCCAAGG + Exonic
952203767 3:31158436-31158458 CTCTGTACTATTAACACACAGGG - Intergenic
953121718 3:40050042-40050064 CTCTATAACATAAAAGTGCAAGG + Intronic
953591947 3:44266071-44266093 CTCTGTAACATAGAAGTGCAAGG - Intronic
954373108 3:50179743-50179765 CTCCAAAACATAAACATGCAAGG - Intronic
956519372 3:70086833-70086855 CTCAGTAATTTACACATGTATGG + Intergenic
957126318 3:76165862-76165884 CTCCATAATATAAAAATGCAAGG + Intronic
957569951 3:81933949-81933971 CTCTGGAATATAAAAATGCATGG - Intergenic
957794502 3:84986497-84986519 CTCTCTAATTTAAAAATTCAAGG - Intronic
958698803 3:97561595-97561617 CTCTGTAACATAAAAGTGCAAGG + Intronic
959390372 3:105765037-105765059 CTCTCTAACATAAAAGTGCAAGG + Intronic
961752642 3:129106253-129106275 CTCTCTAATATGAAGAAGCAAGG - Intronic
962028957 3:131578886-131578908 CTCTGTAACATAAAAGTGTAAGG + Intronic
962280408 3:134048058-134048080 AACTGTAAAATAAAAATGCAAGG + Intronic
962432065 3:135329063-135329085 CTATGTAAATTACACATGCATGG + Intergenic
962541932 3:136391216-136391238 GTCTAGAATAGAAACATGCAGGG + Intronic
962836156 3:139190457-139190479 CTCTATAACATAAAAGTGCAAGG - Intronic
963608757 3:147438789-147438811 CTCTATAACATAAAAGTGCAAGG - Intronic
963746765 3:149132078-149132100 CTCCATAATATAAAAGTGCAAGG + Intronic
964334311 3:155639025-155639047 TGCTGTAATATAGAGATGCATGG - Intronic
964813627 3:160693047-160693069 CTCTGTAACATAGAAGTGCAGGG + Intergenic
965024019 3:163275014-163275036 CTCTGAAATAGAAACAGGCATGG - Intergenic
965595538 3:170407100-170407122 CTCCATAATATAAAAGTGCAAGG + Intergenic
966116340 3:176467851-176467873 CTCCATAACATAAAAATGCAAGG + Intergenic
966750822 3:183320464-183320486 CTCTGTAACATACAAGTGCAAGG - Intronic
966995784 3:185278852-185278874 CTCTATAACATAAAAGTGCAAGG - Intronic
967618482 3:191603053-191603075 ATATATAATATACACATGCAGGG + Intergenic
968766305 4:2471887-2471909 CTCTGTAATGTAAAAGTGTAAGG + Intronic
969888879 4:10241162-10241184 CTGTGTAATCTAAATTTGCATGG + Intergenic
970291219 4:14574715-14574737 CCATGTAATAGAACCATGCACGG + Intergenic
970327619 4:14943720-14943742 TACTGTAAAATGAACATGCAGGG - Intergenic
972204290 4:36753440-36753462 CTGTGTAAAATAAATACGCAAGG - Intergenic
972513594 4:39792694-39792716 GACTGTAAGATAATCATGCAGGG - Intergenic
972591520 4:40492618-40492640 CTCTGTAAGATAATTCTGCATGG - Intronic
972812024 4:42600338-42600360 TTTAGTAATATAAACATGCATGG - Intronic
973109642 4:46381294-46381316 CTCTGAAATAGAAAAATCCATGG + Intronic
973658339 4:53075143-53075165 CTCTCTAACATAAAAGTGCAAGG - Intronic
974706521 4:65524178-65524200 CACTATAATGTAAACATGTATGG + Intronic
975133800 4:70854334-70854356 CTCTGTCATGTAAAAGTGCAAGG + Intergenic
977126966 4:93181656-93181678 CTCTGTAACATAAAAGTGCAAGG - Intronic
978523494 4:109640548-109640570 CTCTATAACATAAAAGTGCAAGG - Intronic
978984706 4:114997315-114997337 CTCCTTGATATAAACATGCTAGG - Intronic
979625948 4:122845597-122845619 CTCCATAACATAAACATGCAAGG - Intronic
979729400 4:124005887-124005909 CTCCATAACATAAAGATGCAAGG - Intergenic
980065457 4:128183047-128183069 CTCCATAATATAAAAGTGCAAGG + Intronic
980116340 4:128682999-128683021 CTCTGCAATGGAAAGATGCAGGG + Intergenic
980706988 4:136511104-136511126 CTCTGTAACATAAAAATGTGAGG - Intergenic
982085076 4:151826782-151826804 CTCTATAACATAAAAGTGCAAGG - Intergenic
982458911 4:155643571-155643593 CTCCATAACATAAAAATGCAAGG + Intergenic
982974985 4:162044767-162044789 CTCTATAATATAAGAGTGCAAGG - Intronic
983086650 4:163453431-163453453 CTCTATGATATAAAAGTGCAAGG - Intergenic
983373609 4:166896811-166896833 CTCTGTAGTATAAAAATTCTAGG + Intronic
984461125 4:180038210-180038232 CTCTATAACATAAAAGTGCAAGG + Intergenic
984685604 4:182664915-182664937 CTCTGCAACATAAAAATGCAAGG + Intronic
986752858 5:10805232-10805254 CTCCAGAACATAAACATGCAAGG + Intergenic
987004704 5:13698283-13698305 CTCTGCAAAAAACACATGCATGG - Intronic
989191042 5:38669986-38670008 CTTTGTAAAATAAAGAGGCAGGG + Intergenic
989205524 5:38805624-38805646 CTCTTTAAGATGAACCTGCAAGG + Intergenic
989634280 5:43517655-43517677 CTCTGTAACATAAAAGGGCAAGG + Intergenic
989654064 5:43725397-43725419 CTCTGTAACATAAAAGTGCAAGG - Intergenic
990009171 5:50975217-50975239 CCCTGTAATTTATACATCCAAGG + Intergenic
990222628 5:53609782-53609804 CTATATAATATAAAAGTGCAAGG - Intronic
990358264 5:54992168-54992190 CTATGTGAAATAAACATGGATGG + Intronic
990677005 5:58198273-58198295 CTCTATAACATAAAAGTGCAAGG - Intergenic
991164308 5:63544705-63544727 CTCAGTAAAATAAATAAGCAAGG + Intergenic
991336159 5:65549628-65549650 CTCCATAACATAAAAATGCAAGG - Intronic
991413108 5:66364806-66364828 CTCCGTAACATAAAAGTGCAAGG - Intergenic
991651340 5:68857883-68857905 CTCTACAACATAAAAATGCACGG - Intergenic
991936190 5:71803157-71803179 CTTCATAATATAAAAATGCAAGG - Intergenic
992216750 5:74532445-74532467 CTCCGTAATATAAAAGTGTAAGG + Intergenic
992302761 5:75401133-75401155 CTCTGTCATATCAACATGCCTGG + Intronic
993751286 5:91671503-91671525 CTCTGTTAACTAAACAGGCAGGG - Intergenic
993866894 5:93206309-93206331 CTATGTAATAGAAAGAAGCAAGG - Intergenic
994004418 5:94820942-94820964 ATCTTTAAAATAACCATGCAAGG + Intronic
994466952 5:100148219-100148241 CTCTACAACATAAAAATGCAAGG - Intergenic
994807830 5:104474865-104474887 CTCCATAATATAAAAGTGCAAGG - Intergenic
994912237 5:105925901-105925923 CTTTGTGATATAAATATGAAAGG - Intergenic
995214350 5:109577896-109577918 CTTTATAATATAAAAGTGCAAGG - Intergenic
995266154 5:110163612-110163634 TTCTGTAATATATAAATACAGGG - Intergenic
996177908 5:120381825-120381847 CTCTATAACATAAAAGTGCAAGG - Intergenic
996482898 5:123995539-123995561 CTCTATAACATAAAAGTGCATGG - Intergenic
996512474 5:124332294-124332316 CTCTATAACATAAAAGTGCAAGG - Intergenic
996517644 5:124390730-124390752 TTCTGTAACATAAAAGTGCAAGG - Intergenic
996635455 5:125683903-125683925 CTCTGTATCATAAACTTTCAAGG + Intergenic
997908021 5:137839720-137839742 TTTTGTATTATTAACATGCATGG + Intergenic
998292946 5:140934139-140934161 CACTGAAATATAAACATATAAGG - Intronic
998814511 5:145999122-145999144 CTCTATAACATAAAAATGCAAGG - Intronic
999835102 5:155361680-155361702 CTCTATAGCATAAAAATGCAAGG - Intergenic
1000501856 5:162062020-162062042 CACTGTAAAATCAACATGTAGGG - Intergenic
1000782595 5:165501686-165501708 CTCCATAACATAAAAATGCAAGG - Intergenic
1000961098 5:167602160-167602182 CTCAGTACTACAAACCTGCAGGG - Intronic
1001360333 5:171078001-171078023 CTCCGTAACATAAAGGTGCAAGG + Intronic
1001953648 5:175833422-175833444 GTCTGTAATACAAAGAAGCATGG + Intronic
1003996137 6:11541373-11541395 CTCTATAACATAAAAGTGCAAGG - Intronic
1004239477 6:13906669-13906691 CTCTGTATTAAAAACACGCATGG + Intergenic
1004658098 6:17684323-17684345 CTCTGTAACATAAAAGGGCAAGG - Intronic
1005246811 6:23895513-23895535 CTCCATAACATAAAAATGCAAGG + Intergenic
1005914176 6:30337948-30337970 CTCTGTAACAAAAATGTGCAAGG - Intronic
1007863869 6:44945739-44945761 CTCTATAATATAAAAGTGCAAGG + Intronic
1007988565 6:46231909-46231931 CTCTGTACTATCAATATCCAGGG - Intronic
1008137048 6:47788900-47788922 CTTTGAAATATCAACATCCAGGG - Intronic
1008406287 6:51121893-51121915 CTTTGTTATCTAAACATGCCTGG - Intergenic
1008516251 6:52322014-52322036 CTCTGTAACTTAAAAGTGCAAGG - Intergenic
1009163958 6:60318248-60318270 CTCTATAACATAAAAGTGCAAGG - Intergenic
1010267971 6:73888856-73888878 TTCTGAAAAATAAAAATGCAAGG - Intergenic
1010898510 6:81396565-81396587 CTCCATAACATAAAAATGCAAGG + Intergenic
1011644815 6:89447511-89447533 CTCTGTAACATAAAAGTGCAAGG + Intronic
1012121738 6:95376732-95376754 CTCTAAAATATAAACAAGCAAGG + Intergenic
1012279831 6:97315483-97315505 GTCTGTAATATACACATGGCAGG - Intergenic
1012498600 6:99863234-99863256 CTCTGTAATACAAAGAGCCAAGG - Intergenic
1012760131 6:103290761-103290783 CTTTGTAATATTAAAATGAAAGG + Intergenic
1013261242 6:108445113-108445135 CTCTATAACATAAAAATGCAAGG - Intronic
1013493573 6:110675048-110675070 CTCTATAACATAAAAGTGCAAGG + Intronic
1014103840 6:117541110-117541132 CTCTGTCATATAAACATTGGAGG + Intronic
1014262479 6:119235563-119235585 CTCTGTAACATAGAAGTGCAAGG + Intronic
1014279406 6:119424138-119424160 CATTTTACTATAAACATGCAAGG + Intergenic
1014474187 6:121852640-121852662 CGCTGTTATATATACATGCCAGG + Intergenic
1014742359 6:125160823-125160845 CTCTGTAACATAAAAGTGCAAGG - Intronic
1015640764 6:135329089-135329111 CTCCGTAACATAAAAGTGCAAGG + Intronic
1016220322 6:141661197-141661219 TTCTATAACATAAAAATGCAAGG - Intergenic
1016443276 6:144106775-144106797 CTCTGAGATAGAAACATGCCTGG - Intergenic
1017300153 6:152847885-152847907 CTCTAGAATATAAACATGTAGGG + Intergenic
1019061030 6:169258367-169258389 CTCTGTAAGACAAAAATGCAAGG - Intergenic
1020090972 7:5340778-5340800 CTCCATAACATAAAAATGCAAGG + Intronic
1020459704 7:8414998-8415020 CTCCATAATATAAAAGTGCAAGG + Intergenic
1022682377 7:32561384-32561406 CTCTATAACATAAAAGTGCAAGG - Intronic
1022899324 7:34787217-34787239 CTCTGTAATATAAACATGCAAGG - Intronic
1023262849 7:38375536-38375558 CTCTGTGATATAAAAATGAGAGG - Intergenic
1024543398 7:50497570-50497592 CTCTGTATCATATAAATGCATGG - Intronic
1024733718 7:52280065-52280087 CTCTGGCATATATACATACATGG - Intergenic
1026042503 7:66879782-66879804 CTCTTTCATATGAACATGAAGGG + Intergenic
1026507773 7:71000561-71000583 CTCTATAACATAAAAATGCAAGG + Intergenic
1027006135 7:74694609-74694631 CTCTATAACATAAAAGTGCAAGG + Intronic
1027276013 7:76556872-76556894 ATCTGTAATATAAAAGTGCAAGG + Intergenic
1027742464 7:82027904-82027926 CTCTATAACATAAAAGTGCAAGG + Intronic
1028308897 7:89304157-89304179 CTTTGAAATATAATCATGGAAGG + Intronic
1029980996 7:104879108-104879130 CTCTGTGACATAAAAGTGCAAGG + Intronic
1030426037 7:109379637-109379659 CTCTGTAACATAAAAGTACATGG + Intergenic
1030850872 7:114485880-114485902 AGCTGTAATACAAACATGTATGG + Intronic
1031496741 7:122458617-122458639 CTTTTTAAAATAAACATCCAAGG - Intronic
1032753426 7:134865248-134865270 CTCTGTGATATAAGGGTGCAGGG + Intronic
1032880115 7:136080361-136080383 CTCTTTAATATAAAGATGTGGGG + Intergenic
1033139936 7:138816989-138817011 CTCTGTAACATAAAAGTGCAAGG + Intronic
1033845898 7:145431722-145431744 CTCTGTAACATAAAAGTGCAAGG - Intergenic
1034226033 7:149483297-149483319 TTTTTTAATATAAACATACAAGG - Intronic
1036039852 8:5064390-5064412 CTCAGTAACATAAAAGTGCAAGG + Intergenic
1037417172 8:18664540-18664562 CCCTGTAATATAAAAGTCCAAGG + Intronic
1038560767 8:28577366-28577388 CTCTTTAATCTAATCAAGCATGG + Intergenic
1038588239 8:28811061-28811083 CTTTGTAATACAAACACTCACGG + Intronic
1038621840 8:29151309-29151331 CTCTGTAACATAAAAGTGCAAGG + Intronic
1039337283 8:36605775-36605797 CTCTGTAACATAAATGTGAAAGG - Intergenic
1041277301 8:56175963-56175985 CTCTATAAAATAAACAACCAAGG - Intronic
1042093746 8:65189183-65189205 CTCTGTATTTTATAAATGCAGGG - Intergenic
1042099946 8:65264827-65264849 CTCTATAACATAAAAGTGCAAGG - Intergenic
1042525016 8:69755390-69755412 CTCTTGAATAAATACATGCATGG - Intronic
1044171872 8:89063463-89063485 CTTTTTAATACAGACATGCAAGG + Intergenic
1044807778 8:96025998-96026020 CTCCATAATATAAAAATACAAGG + Intergenic
1045163450 8:99575562-99575584 CTTTGTACTACAAACATGTATGG - Intronic
1045745218 8:105410586-105410608 CTTTGTTATATAAACATATAGGG + Intronic
1045791555 8:105989916-105989938 CTTTGAAATGTAAACATGAACGG + Intergenic
1046014020 8:108584385-108584407 CTCTCTAAAATAAAAATGCTAGG - Intergenic
1046068684 8:109224381-109224403 CTATGTGACAGAAACATGCAAGG + Intergenic
1046353191 8:113043172-113043194 CCCTTAAATACAAACATGCAGGG + Intronic
1047663972 8:127069468-127069490 CTCTATAATATAAAAGTACAAGG + Intergenic
1048051785 8:130824755-130824777 CACTGTAAAATGAAAATGCAGGG + Intronic
1048433429 8:134391991-134392013 CCCTGTAACATAAAAGTGCAAGG + Intergenic
1048645841 8:136418130-136418152 CTTTGAAATGTAATCATGCAAGG - Intergenic
1050808396 9:9713704-9713726 CCCTGTAATAAAAGCATGAATGG - Intronic
1050842734 9:10172698-10172720 CTCTGTATTATAAACTTTCTTGG - Intronic
1051202792 9:14647626-14647648 CTGTGGAATATAAACAAGTAGGG - Intronic
1051298288 9:15619603-15619625 CTACATAATATAAAAATGCAAGG + Intronic
1051542938 9:18240838-18240860 CTCTATAACAGAAAAATGCAAGG - Intergenic
1052474649 9:28943333-28943355 CTCTCTAAAATAAAGATCCAAGG + Intergenic
1053132577 9:35625465-35625487 CTCTATAACATAAAAGTGCAAGG + Intronic
1053217712 9:36286347-36286369 CTCTATAACATAAAAGTGCAAGG - Intronic
1053310138 9:37012851-37012873 CTCTATAATGCAAAGATGCAAGG - Intronic
1055275388 9:74610201-74610223 TTCTGTAAAATAAAAATGCCTGG + Intronic
1055297068 9:74844456-74844478 CTCTGTAATATAAAAGTTCAGGG - Intronic
1055377280 9:75662915-75662937 CTCCTTAACATAAACATGCAAGG + Intergenic
1055402359 9:75937786-75937808 CTCTGTAACATAAAAGTGCAAGG - Intronic
1055557136 9:77486213-77486235 CTCTGTAACATAACAGTGCAAGG - Intronic
1056274326 9:84978537-84978559 CTCCATAATATAAAAGTGCAAGG + Intronic
1057036389 9:91814705-91814727 CTCTGTAAGATAAAAATGACAGG + Intronic
1057843619 9:98505475-98505497 CTCTGCACTGTGAACATGCATGG - Intronic
1059711889 9:116875462-116875484 CTCTGTATCATAAAAGTGCAAGG + Intronic
1061494687 9:130965638-130965660 CTCCATAATACAAAAATGCAAGG + Intergenic
1185797815 X:2981795-2981817 CTCTGGATTACAAATATGCATGG + Intergenic
1186386000 X:9110694-9110716 CTCTCTAAGACAAAAATGCAAGG + Intronic
1188174291 X:26969605-26969627 CTCTGTAAAATAGACAGACATGG - Intergenic
1188428357 X:30075856-30075878 CCCTGAAATATAGACAAGCAAGG - Intergenic
1188448259 X:30280484-30280506 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1188583288 X:31741983-31742005 CTCTATAACATAAAAGTGCAAGG - Intronic
1188855574 X:35191182-35191204 CTCCGTAACATAAAAGTGCAAGG - Intergenic
1189174606 X:38943166-38943188 CTCCATAATATAAAAGTGCAAGG + Intergenic
1190199568 X:48348958-48348980 CTCTATAACATAAAAGTGCAAGG + Intronic
1190204330 X:48390492-48390514 CTCTATAACATAAAAGTGCAAGG - Intronic
1190206206 X:48404911-48404933 CTCTATAACATAAAAGTGCAAGG + Intronic
1190210169 X:48440142-48440164 CTCTATAACATAAAAATGCAAGG - Intergenic
1190460772 X:50671524-50671546 CTCTATAACATAAAAGTGCAAGG - Intronic
1190715647 X:53100901-53100923 CTCCGTAACATAAAAGTGCAAGG - Intergenic
1190814195 X:53914432-53914454 CTCCATAACATAAAAATGCAAGG + Intergenic
1192230031 X:69258106-69258128 ATATGTAATGAAAACATGCATGG + Intergenic
1193077553 X:77371323-77371345 CTCTGTACAAAAAAGATGCAGGG - Intergenic
1194039792 X:88926460-88926482 TTCAGTAATATAAAAAGGCAAGG + Intergenic
1195557195 X:106240771-106240793 CTCTGTTATATACATATACACGG - Intergenic
1195690811 X:107623530-107623552 CTCCGTAACATAAACGTGCAAGG - Intergenic
1195954326 X:110313465-110313487 CTCTGTAACAAAAATATGAAAGG - Intronic
1196564100 X:117184314-117184336 CTCTGTAACATAAAACTACAAGG + Intergenic
1196617424 X:117783255-117783277 CTCTGTAATAAAAACTTGATAGG + Intergenic
1198634543 X:138681296-138681318 CTCTGTAACATAAAAGTGCAAGG - Intronic
1198970637 X:142275116-142275138 CTCCATAACATAATCATGCAAGG - Intergenic
1200610290 Y:5320244-5320266 ATCTGTAATATAAAAATATATGG + Intronic
1201448601 Y:14084936-14084958 CTGTGCAAAATAAAAATGCAGGG - Intergenic
1201613251 Y:15866503-15866525 CCCTGAAATATATAAATGCAGGG + Intergenic
1201642151 Y:16191486-16191508 TTCTGTAATATGAACAGGCATGG + Intergenic
1201660664 Y:16393835-16393857 TTCTGTAATATGAACAGGCATGG - Intergenic
1201862535 Y:18615184-18615206 ATTTGTAATATGAAGATGCAGGG - Intergenic
1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG + Intergenic