ID: 1022899939

View in Genome Browser
Species Human (GRCh38)
Location 7:34797412-34797434
Sequence CTCTGTGTATGGGGGACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022899927_1022899939 28 Left 1022899927 7:34797361-34797383 CCACTGTAACAAATATACCACTC 0: 1
1: 3
2: 15
3: 50
4: 189
Right 1022899939 7:34797412-34797434 CTCTGTGTATGGGGGACAGGGGG 0: 1
1: 0
2: 3
3: 36
4: 308
1022899929_1022899939 11 Left 1022899929 7:34797378-34797400 CCACTCTTGCATGGAAGCGTGAT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022899939 7:34797412-34797434 CTCTGTGTATGGGGGACAGGGGG 0: 1
1: 0
2: 3
3: 36
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022899939 Original CRISPR CTCTGTGTATGGGGGACAGG GGG Intronic
900255601 1:1697064-1697086 CTCTGTGCAGAGGGGACAGGAGG - Intronic
900264272 1:1749687-1749709 CTCTGTGCAGAGGGGACAGGAGG - Intergenic
902257594 1:15200065-15200087 TTCTGAGTACTGGGGACAGGGGG - Intronic
902341455 1:15786006-15786028 GTTTGTGTTTGGGGGAGAGGGGG - Intronic
902816374 1:18918858-18918880 CTGCCTGTGTGGGGGACAGGTGG - Intronic
902897434 1:19488638-19488660 CTCTGCATATGTGGGGCAGGGGG - Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904687784 1:32273318-32273340 CTCTGTGGAGGTGGGATAGGGGG + Intronic
904983126 1:34523423-34523445 CTGTGTGTACTGGGGACAGGGGG - Intergenic
905985962 1:42282554-42282576 CTCAGTGGTTGGGGGAGAGGAGG - Intronic
906746619 1:48226417-48226439 CTCTGTGTTTGGGGCGCAGTGGG - Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907422653 1:54357548-54357570 CCCTGTGGATGGGGGAGAGGTGG - Intronic
908956574 1:69637104-69637126 CTCTGTGTGCGGGGGAGCGGGGG - Intronic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
910500443 1:87883955-87883977 CTCTGTGTAAAGGGGTCAGAGGG + Intergenic
912680529 1:111726277-111726299 CCCTGTGCATGGGGGAGACGCGG + Exonic
912716490 1:111987497-111987519 CTCTGTGTGTGGGGGTTGGGAGG + Intronic
915296693 1:154926323-154926345 CTCTATGTGTAGGGCACAGGAGG - Intronic
915380372 1:155434274-155434296 TTCTAGGAATGGGGGACAGGGGG + Intronic
915624515 1:157106537-157106559 CTCTGTGTTGGGGGGACAAAGGG - Intergenic
917329617 1:173868266-173868288 CTCTGGGGATGGGGGAAGGGGGG + Intronic
917582391 1:176391976-176391998 TTCTGTGAGTGGGGGAAAGGTGG - Intergenic
917973556 1:180224316-180224338 CTGTGTGTATGGGGGAGCTGGGG - Intergenic
918412222 1:184271753-184271775 CTCTGTGTGTCAGGTACAGGGGG - Intergenic
920243779 1:204573049-204573071 CTCTGTGTTCAGGGGACAGTGGG + Intergenic
921224166 1:213000807-213000829 CTGTGTGTATGAGGTACAGCAGG - Exonic
921245320 1:213232805-213232827 CTCTTTGTAGAGGGAACAGGTGG + Intronic
922210346 1:223481446-223481468 CTGTGTGTTTGGGAGTCAGGAGG - Intergenic
1063174670 10:3540592-3540614 CTGTGTGTGTGGGGGAGAGTGGG - Intergenic
1066662262 10:37748129-37748151 CTCTGTGTATGGTGAGCATGTGG + Intergenic
1068130077 10:52885717-52885739 CACTGAATATGGGGGAAAGGTGG - Intergenic
1068404154 10:56568702-56568724 CTCAGTGGGTGGGGGACAAGGGG - Intergenic
1068828665 10:61468527-61468549 GTCTGTGTGTGGGAGGCAGGAGG - Intergenic
1069043362 10:63717826-63717848 CTCTGGGCATTGGGGGCAGGGGG - Intergenic
1069745739 10:70713734-70713756 CGCTGTGTATGGGGGTGAGTTGG + Intronic
1069876441 10:71566149-71566171 CTCTGTCCACTGGGGACAGGAGG - Intronic
1070151097 10:73805630-73805652 TTCTGTGCAAGTGGGACAGGAGG + Exonic
1070826339 10:79392379-79392401 CTCAGTGAATGGGAGACAAGCGG - Intronic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1071617381 10:87087675-87087697 CTGTGTGTAAGGGGGTCATGAGG - Intronic
1071826321 10:89329633-89329655 CTCAGTGGATGGGGCAGAGGAGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073896765 10:108169842-108169864 CTATATGGATGTGGGACAGGAGG - Intergenic
1076896989 10:133317810-133317832 CTCTGTGTCTGGGGGGGGGGGGG - Intronic
1078293482 11:10040732-10040754 GTGTGTGTATGGGGGAGATGGGG + Intronic
1079102267 11:17549064-17549086 CTCTGTGTTTGTGGGAGAGGTGG + Intronic
1079194691 11:18315254-18315276 CTCTGTGCTTGGTGGAGAGGTGG - Intronic
1080551251 11:33375896-33375918 TTCTCTAGATGGGGGACAGGAGG + Intergenic
1080845068 11:36019816-36019838 CTCTGTGGATGGAGGACTGGAGG + Intronic
1081577515 11:44328371-44328393 CTCTGGGCCTGGGGGAGAGGAGG - Intergenic
1081640310 11:44748765-44748787 CACTGTGAATGGGGGAGGGGCGG + Intronic
1082254489 11:50018575-50018597 CTCTGTGTATGAGAGAGAAGAGG + Intergenic
1083717217 11:64584321-64584343 CTCTGTGTTGGGAGGACAAGAGG - Intergenic
1083882678 11:65556175-65556197 CTCTGTGTGTGTGTGACAAGAGG - Intronic
1084718035 11:70885844-70885866 CTTTGTGTAAGGGCCACAGGTGG - Intronic
1086323997 11:85680138-85680160 TTCTGTGTAAGGGGGAGAGGAGG - Intronic
1087186435 11:95203079-95203101 CTTGGTGTATGAGGGACAAGTGG + Intronic
1087466102 11:98508320-98508342 CTTTGTGTATGTGGGAGAAGGGG + Intergenic
1087790988 11:102406276-102406298 CTCTGTCTATGGGGGTAAAGAGG + Intronic
1089408221 11:118216478-118216500 CTCTGTGTAAGTGGGACCTGAGG - Intronic
1090223154 11:125048662-125048684 ACCTGTGTTTGGGGGCCAGGGGG - Intergenic
1090890059 11:130915661-130915683 CTCAGGGCATGGAGGACAGGTGG + Exonic
1091609721 12:1995638-1995660 GTCTGTGTATGCTGGGCAGGAGG - Intronic
1091617367 12:2059599-2059621 CTGTGTGTATAGGGGGCAAGGGG + Intronic
1092046510 12:5434761-5434783 CTGTGTGTGTGAGGGAAAGGTGG + Intronic
1092070582 12:5628214-5628236 CTCTGTGCATGTGGGACAGGCGG + Intronic
1092396687 12:8133737-8133759 TTCTAGGAATGGGGGACAGGGGG - Intronic
1093301605 12:17465158-17465180 CTCAGTGTATGGGGCTCTGGGGG - Intergenic
1094099524 12:26746329-26746351 CTCAGTGAATGTGGGACATGGGG - Intronic
1095965252 12:47863174-47863196 CGCTGTTTATGGGGACCAGGAGG + Intronic
1096529353 12:52233452-52233474 CTCTGCCTATGGGGGCCCGGTGG + Exonic
1097473700 12:60027336-60027358 CCCTGTGCTTGGGGGACAGGAGG - Intergenic
1098417185 12:70247488-70247510 GTATGTGTGTGGGGGGCAGGTGG + Intronic
1098484110 12:71000874-71000896 GTGTGTGTATGGGGGATAGCGGG - Intergenic
1100864552 12:98843030-98843052 CTCTCTGGATGGGTAACAGGTGG + Intronic
1100902036 12:99252519-99252541 CTCTGTGTTTCGGGGCCATGGGG - Intronic
1101523274 12:105504486-105504508 CTCTGTGTTTAGTGGCCAGGGGG - Intergenic
1101684954 12:107009810-107009832 CTTTGTTTATGGGGGACACTTGG + Intronic
1102181132 12:110913182-110913204 GTGTGTGTAGGGGGGACAGGGGG + Intronic
1106508443 13:30392193-30392215 CTGTTTGTCTGGGGGAAAGGAGG - Intergenic
1107896649 13:44971424-44971446 CTCTTTTTATGTAGGACAGGTGG - Intronic
1112619599 13:101041106-101041128 CTCAGGGGATGGGGGACAAGGGG - Intergenic
1112685912 13:101826256-101826278 TTCTGTGTATCGGGGACGGGGGG - Intronic
1113651185 13:112035322-112035344 CCCTCTGGGTGGGGGACAGGAGG - Intergenic
1113651206 13:112035390-112035412 CCCTCTGGGTGGGGGACAGGAGG - Intergenic
1113787737 13:113011482-113011504 CGGTGTGGATGGTGGACAGGTGG + Intronic
1113787761 13:113011605-113011627 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787827 13:113011932-113011954 CGGTGTGGATGGTGGACAGGCGG + Intronic
1113787850 13:113012055-113012077 CAGTGTGAATGGTGGACAGGTGG + Intronic
1113787857 13:113012096-113012118 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787873 13:113012177-113012199 CAGTGTGGATGGTGGACAGGCGG + Intronic
1113787895 13:113012300-113012322 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787968 13:113012689-113012711 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113913215 13:113854503-113854525 CTCTGTGTTTGGGGCAGAGACGG - Intronic
1117017881 14:51536938-51536960 GACTGTGTGTGGGGGGCAGGGGG - Intronic
1117195450 14:53335813-53335835 CTGTGTGTGTAGGGGCCAGGTGG + Intergenic
1117582148 14:57162290-57162312 CTGAGTGTGTGGGGGCCAGGAGG - Intergenic
1117666586 14:58062335-58062357 TTCTTTATTTGGGGGACAGGAGG - Intronic
1121522813 14:94598069-94598091 CTCTGTGCATCGGGGACAACAGG - Intronic
1122877950 14:104677457-104677479 CTAGGGCTATGGGGGACAGGAGG + Intergenic
1202855839 14_GL000225v1_random:51757-51779 CTCTGTGTATGGGGGCTTTGTGG - Intergenic
1123934867 15:25189208-25189230 CTCACTATCTGGGGGACAGGAGG - Intergenic
1123943991 15:25230136-25230158 CTCTGTGTCTGGGAGATATGTGG + Intergenic
1125067014 15:35499543-35499565 CACTGTGTTTTGGGGAAAGGAGG + Intronic
1125383011 15:39107440-39107462 GTCTGTATATGAGGAACAGGAGG + Intergenic
1125766770 15:42141575-42141597 CTCAGTGTAAGGAGGACAGCTGG + Exonic
1127033075 15:54885478-54885500 GTCTGTGTATGGTGTACATGAGG + Intergenic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1130292776 15:82618925-82618947 CTTTGTGTATGTGGGGCAGGGGG + Intronic
1130667679 15:85883639-85883661 CTCTATGAATGGGGAAAAGGTGG + Intergenic
1131262098 15:90892848-90892870 CTCTGTGTATGCGGGACCCGTGG - Intronic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1132405166 15:101537416-101537438 TGCTGTGTTTGGGGCACAGGTGG - Intergenic
1132583871 16:697418-697440 CTCTGTGGATGAGGGCCGGGAGG + Exonic
1132590826 16:725749-725771 CTCAGTGCATGGGGGACGGGGGG - Intronic
1133754931 16:8755323-8755345 CTCTGTGTAGGAGGCAGAGGTGG + Intronic
1133929927 16:10223825-10223847 CTCAGAGTGTGGGTGACAGGTGG + Intergenic
1135052838 16:19206416-19206438 CTCAGTGTATGTGGGAGAGCTGG + Intronic
1137255232 16:46769562-46769584 CTCTGGGTATGGGGTCGAGGAGG - Intronic
1137272011 16:46908164-46908186 TCCTGTGTTTGGGGGACTGGTGG + Intronic
1137272045 16:46908284-46908306 TCCTGTGTTTGGGGGACTGGTGG + Intronic
1139842764 16:69894837-69894859 CTCTGTGTGTGTGGGACCGAGGG - Intronic
1140402860 16:74685657-74685679 CTCTGTGTATGTGGGGGCGGGGG + Intronic
1141497149 16:84418203-84418225 CCCTGTGTGTGGGAGATAGGAGG + Intronic
1142043008 16:87907332-87907354 CTGTGTCTGTGGGGGAAAGGGGG + Intronic
1142308520 16:89299162-89299184 CCCTGTGTATCGAGGAGAGGAGG + Intronic
1142772665 17:2110567-2110589 CTCTGTGTTGGGGGGACTGATGG + Intronic
1142990992 17:3730770-3730792 CTCTGTGTTGGGGGGTAAGGTGG - Intronic
1143001625 17:3798463-3798485 TTCTGTGCAGGGGGGATAGGAGG - Intronic
1143250121 17:5517354-5517376 GTCTGTGTATGTGGGAGGGGGGG - Intronic
1143254474 17:5545307-5545329 CTGTGTGTAAGAGAGACAGGGGG - Intronic
1143256660 17:5562551-5562573 CTGTGTGTGTTGGGGACAGGGGG - Intronic
1143352418 17:6298437-6298459 CATTGTGTGTGGGGGACAAGTGG - Intergenic
1143999360 17:11038271-11038293 GTGTGTGTATGGGGTGCAGGTGG + Intergenic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1144950759 17:18992254-18992276 CTCTGTGTCCTTGGGACAGGGGG + Intronic
1145016647 17:19403132-19403154 CACTGGGCCTGGGGGACAGGAGG + Intergenic
1146645982 17:34578038-34578060 CTCTGTGTGGGGGAGAAAGGGGG - Intronic
1148737790 17:49874495-49874517 CTCTGTGGATGGGTGGGAGGTGG + Intergenic
1148804399 17:50257111-50257133 CTCTGAGCCTGGGGGACAGCAGG + Intergenic
1148869605 17:50648747-50648769 CTCTGTGTGTTGGGGGCAGGTGG - Intronic
1150652199 17:67017467-67017489 CACTGGGAATGGGGCACAGGGGG - Intronic
1151434187 17:74084017-74084039 CTCTCAGTATGAGGGGCAGGGGG + Intergenic
1151437911 17:74109568-74109590 CTCAATCTCTGGGGGACAGGGGG + Intergenic
1151939454 17:77283296-77283318 CTCTGAGGATGGGGGAAGGGAGG + Intronic
1152489364 17:80619254-80619276 CTCTCAGTGTGGGGGACAGAAGG + Intronic
1152742448 17:82024257-82024279 CCCTGTGTAAGGGGGGCCGGCGG - Exonic
1154369611 18:13747872-13747894 TGCTGTATATGTGGGACAGGGGG - Intronic
1156034512 18:32751598-32751620 CTCTGTGTGTGAGGAAGAGGAGG - Intronic
1156223227 18:35075368-35075390 CTCTGTGGATGGAAGAGAGGAGG - Intronic
1157434899 18:47660000-47660022 CTCTGTGTAGTGGGGGCAGGTGG + Intergenic
1158072426 18:53488765-53488787 TTGTGTGTATGTGGGATAGGAGG + Intronic
1159913164 18:74165463-74165485 CTTTCTGTAGAGGGGACAGGAGG - Intergenic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1160673186 19:375956-375978 ACCGGTGTATGGGGGACAGCAGG - Exonic
1160981897 19:1820050-1820072 TTCAGTGCCTGGGGGACAGGCGG + Exonic
1161150510 19:2705665-2705687 ATCTATGTATGGGGTACATGTGG - Intergenic
1162612253 19:11765967-11765989 CGCTGTGTTTAGGAGACAGGAGG + Intergenic
1162907611 19:13833086-13833108 CTCCGTGGGTGGGGGGCAGGGGG + Intergenic
1165490179 19:36118869-36118891 GGCTGTGTGTGGGGAACAGGTGG + Intronic
1166512127 19:43415982-43416004 CTGTGCGTATGGGGGACATAGGG + Exonic
1168164503 19:54537477-54537499 CTCTGTGTTGAGGGGTCAGGAGG - Intronic
926012200 2:9417236-9417258 CTGTGTGTTTGGGGGACAGCAGG - Intronic
926315874 2:11709166-11709188 CTCTGAGTAGGGGGGAGATGGGG - Intronic
929220346 2:39457947-39457969 CTCTGTGTAGCTGGGACCGGAGG - Intergenic
929875043 2:45789626-45789648 CTCTCTGGTTGGGGGAAAGGGGG + Intronic
930325654 2:49914045-49914067 CTCTGTGGATGGGGAAAATGTGG - Intergenic
931366854 2:61626733-61626755 TTCTGGGTGTGGGGGACAGCAGG - Intergenic
932347978 2:71007918-71007940 CTGTGTGTAGTGTGGACAGGAGG - Intergenic
934632041 2:95936909-95936931 CTGTGTCTATGGGAGAGAGGAGG - Intronic
934767180 2:96886190-96886212 GTCTGAGTGTAGGGGACAGGAGG - Intronic
934801462 2:97166312-97166334 CTGTGTCTATGGGAGAGAGGAGG + Intronic
935989241 2:108704714-108704736 CTGGGGATATGGGGGACAGGTGG - Intergenic
937237112 2:120437673-120437695 CTCTGTGTGTGGGGGATTGAAGG - Intergenic
937946681 2:127344864-127344886 CACTTTTTTTGGGGGACAGGAGG + Intronic
938560658 2:132469587-132469609 CTCTGGTTATGCGGGCCAGGTGG + Intronic
939018922 2:136935782-136935804 CTCTGTGAAGGGGGGACAGTTGG + Intronic
939504593 2:143029964-143029986 CACTGGGCATGGAGGACAGGAGG + Intronic
941932417 2:170955361-170955383 CTATGTGTGTGGGGGTCATGAGG + Intronic
942025682 2:171908366-171908388 CTCTTCGTATGAGGTACAGGTGG - Intronic
942313246 2:174675813-174675835 CTCTGTGTGTGGGGTGGAGGCGG + Intronic
942530518 2:176904957-176904979 CTATGTGTATGTGGTAGAGGAGG + Intergenic
946179155 2:217939691-217939713 CCCTGGGTGTGGGAGACAGGAGG - Intronic
946531109 2:220571237-220571259 CTCTGTGTGTGTAGGAGAGGGGG - Intergenic
946586116 2:221189688-221189710 GTGTGTGTTTGGGGGGCAGGGGG - Intergenic
947442838 2:230138246-230138268 CACTTTGGATGGGGTACAGGTGG + Intergenic
948102269 2:235384609-235384631 CTCTGTGAATGGGGATCAGCGGG - Intergenic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
1168961858 20:1875548-1875570 GTCTGTGTATGGGGGAGTGTGGG - Intergenic
1169111780 20:3038795-3038817 GGCTGTGTTTGGTGGACAGGAGG - Intronic
1170779278 20:19409277-19409299 CTCTGTGCATGGGCGAGGGGAGG + Intronic
1172323350 20:34015175-34015197 TTCTGAATAAGGGGGACAGGTGG - Intronic
1173000811 20:39104373-39104395 ATCTGTGTGTGGGGGAGAGGAGG + Intergenic
1173117796 20:40262827-40262849 CTCTGTCTTTGGGGGGTAGGAGG - Intergenic
1174080760 20:47969330-47969352 CGTGGTGTATGTGGGACAGGTGG - Intergenic
1175514023 20:59557329-59557351 CACTGTGTGTTGGGGGCAGGGGG + Intergenic
1177038622 21:16077266-16077288 CTCTGTGTTTGGGGGCCACTAGG + Intergenic
1179044067 21:37829515-37829537 CTGGGTGTGTGGGGGCCAGGGGG + Intronic
1179552223 21:42150639-42150661 CGCTGTGTTTGGGGGACTGGCGG - Intergenic
1179824623 21:43957219-43957241 CTCTGTGGAGTCGGGACAGGGGG + Intronic
1180166023 21:46029607-46029629 GTGTGTGGAGGGGGGACAGGGGG - Intergenic
1183315939 22:37136811-37136833 CTATGTGTCTGGGGAGCAGGAGG - Intronic
1183321369 22:37167068-37167090 CTCTGAGTCTGGGGGTTAGGTGG - Intronic
1184889224 22:47369274-47369296 AGCTGCCTATGGGGGACAGGAGG + Intergenic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950240580 3:11366371-11366393 CCTTGTGTGTGGGGGACAGAGGG - Intronic
950312413 3:11970118-11970140 CTTTGTGTGTGGGGGAGAGGAGG - Intergenic
950477554 3:13223529-13223551 AGCTGGGAATGGGGGACAGGTGG + Intergenic
951955001 3:28243797-28243819 GTCTGTGTAGGGGGAAAAGGGGG - Intronic
952648250 3:35689031-35689053 GTCTGGGTGTGGGGGAGAGGTGG - Intronic
953090971 3:39725880-39725902 CTCTGTGTCCGGGGGAAAGAGGG - Intergenic
953270472 3:41437966-41437988 CTCTGGGGATGGGGAACTGGTGG + Intronic
953495771 3:43385886-43385908 ATATGTTTTTGGGGGACAGGTGG - Intronic
953680573 3:45035467-45035489 CTCTTTGCCTGGGGAACAGGGGG + Intronic
954151105 3:48657550-48657572 CTCCGTGTATTGGGGATTGGGGG - Intronic
954210345 3:49093726-49093748 CCCTGTGGATGGGGGAGGGGTGG - Intronic
955412576 3:58665332-58665354 CTCTGAGAAGGGGGAACAGGAGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958581587 3:96032466-96032488 CTTTGTGTGTGGGGGAGAGTAGG + Intergenic
958942466 3:100331416-100331438 CTCAGTTTTTGGGGGAGAGGTGG - Intergenic
959341347 3:105135396-105135418 CCCTGTGTGTGGTGGAAAGGTGG - Intergenic
960335016 3:116406704-116406726 CTGTGTGCATGGAGAACAGGAGG - Intronic
960350017 3:116580970-116580992 CTCTGTGTATCAGTGCCAGGAGG + Intronic
960704477 3:120468900-120468922 CTCTGAGGAGGGGGGACAGCTGG - Intergenic
960705613 3:120477911-120477933 CTCTGAGGAGGGGGGACAGCTGG + Intergenic
961501947 3:127342544-127342566 CTCTGAGTTTGGGGGACACAAGG + Intergenic
961722145 3:128903852-128903874 CTCTGTGTGTGGGTGCCATGAGG + Intronic
961787023 3:129353456-129353478 AGCTGGGGATGGGGGACAGGTGG - Intergenic
962373625 3:134841394-134841416 CACTCTGTATGTGGGACAGGTGG + Intronic
966496928 3:180591102-180591124 TGCTGTGTATGAGGGAGAGGGGG + Intergenic
967408009 3:189138765-189138787 CTTTGTGTCTGGAGAACAGGAGG + Intronic
968226466 3:196975507-196975529 CTCTGTGTCTGAGGGCCAGCAGG + Intergenic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
970617717 4:17782870-17782892 CTCTGAGGATGGGGGTCAGGGGG + Intergenic
972384700 4:38553792-38553814 CTCTGTGTTTGGGGGACACCAGG - Intergenic
972618081 4:40719391-40719413 CTCTGTTTTTGAGGGGCAGGGGG + Intergenic
974023344 4:56711185-56711207 TTCTGAGTCTGGGGGGCAGGGGG - Intergenic
974431808 4:61808012-61808034 GGCAGTGTATGGGGGACAGGAGG - Intronic
975172448 4:71247707-71247729 CTCTGTGTTTGGCTCACAGGTGG + Intronic
975280197 4:72553323-72553345 CTCTGTGTATGTCTTACAGGAGG - Intronic
977403733 4:96569244-96569266 CTCTATTTATGGGCGACAGGAGG + Intergenic
978507977 4:109481109-109481131 CTCTGGGAGTGGGGGACGGGGGG - Intronic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981373184 4:143983941-143983963 GTGTGTGTCTGGGAGACAGGAGG + Intergenic
982899582 4:160981250-160981272 GCCTGGGTTTGGGGGACAGGAGG + Intergenic
983897789 4:173100088-173100110 CACTGTGTGTTGGGGGCAGGGGG - Intergenic
984512864 4:180699799-180699821 CTGTGAGTATGGGAAACAGGTGG - Intergenic
984937045 4:184898520-184898542 CTCAGTGTTAGGGGGGCAGGTGG + Intergenic
985768341 5:1793588-1793610 CTCTGTGTGTGGGAGACACATGG + Intergenic
986056470 5:4142193-4142215 CTTTGTGTGTGGGTGACTGGAGG + Intergenic
986365726 5:7028671-7028693 TTCAGTGTTTGGGGGAAAGGTGG - Intergenic
988493905 5:31728223-31728245 GTCTGTGTAATGGGGACATGGGG - Intronic
990152936 5:52840908-52840930 ATCTGTGTCTGGTGGAAAGGAGG - Intronic
993387481 5:87277308-87277330 CTATGACTATGGGGGACAGGGGG - Intronic
994357484 5:98810300-98810322 CTTTGTTTATGGAGAACAGGAGG - Intergenic
996778718 5:127160396-127160418 CTCTGTTTATGGAATACAGGCGG + Intergenic
997648616 5:135498391-135498413 CTCTGTGTGTGAGGCAAAGGCGG + Intergenic
998983991 5:147734896-147734918 CTCTGTGTAAAGTGGACAGATGG + Intronic
999056618 5:148584869-148584891 CTCTGTGTATGGCTTCCAGGTGG - Intronic
1001571772 5:172735053-172735075 TTGTGTGTATGGGGGCCAGTTGG + Intergenic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001952179 5:175824025-175824047 CTGTGGGTGTTGGGGACAGGAGG - Intronic
1002276638 5:178108256-178108278 CCCTGAGTGTGGGGGACTGGTGG - Intergenic
1002493864 5:179598907-179598929 CCCTTTGTGTGGGGGCCAGGCGG + Intronic
1002540150 5:179901273-179901295 CTCTGTGCATCAGGGAAAGGAGG - Intronic
1003425937 6:5998385-5998407 CTTTGTGTTTGGAGGATAGGAGG - Exonic
1005887412 6:30107347-30107369 GTTTGTGTATGGGGGGCTGGGGG + Intronic
1006028832 6:31164567-31164589 TTCTAGGAATGGGGGACAGGGGG - Exonic
1006115675 6:31775011-31775033 CTCTGTGAGTTGTGGACAGGAGG + Intronic
1006639034 6:35479568-35479590 CTCTGGGCATGGGGGCCTGGGGG + Intronic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007407920 6:41645358-41645380 CTCTGTGCAGGGGCGGCAGGAGG - Intronic
1007872328 6:45054299-45054321 CTCTGTGTGTGGGGTACATGAGG - Intronic
1008480365 6:51979556-51979578 CTATGTGTTGGGGGGAGAGGAGG - Intronic
1008683222 6:53896419-53896441 GTGTGTGTATGGGGGAAGGGAGG + Intronic
1011850076 6:91615921-91615943 CTCAGTGTCTTGGTGACAGGAGG - Intergenic
1012884309 6:104827126-104827148 ATCAGTGTATTGGGCACAGGTGG - Intronic
1013729136 6:113142309-113142331 CTCATTGCATGGGGGAGAGGAGG + Intergenic
1014692328 6:124577385-124577407 CTGTGTGCTTGGGGGACAGAAGG + Intronic
1018329468 6:162711736-162711758 CTCTCTATATGGGGGAAAGTAGG + Intronic
1018522136 6:164661899-164661921 AGCTGTATATGGGAGACAGGAGG - Intergenic
1018769425 6:166957805-166957827 CACAGTGGATGGGGGACAGTCGG + Intergenic
1018849672 6:167577976-167577998 CTCTGTGCATGGGGAGCAGGGGG - Intergenic
1019701720 7:2477519-2477541 CCCTGCGGATGGGGGACTGGAGG - Intergenic
1021287978 7:18805927-18805949 CTCTGTGTGTTGGGGAGAGGAGG - Intronic
1021638179 7:22711869-22711891 CTCTGTGTTTGGGGAACCAGTGG - Intergenic
1022034522 7:26521081-26521103 ATCTGTGTCTGGAAGACAGGAGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022506483 7:30911245-30911267 CTCTGTGGATGGGGGCACGGAGG - Intergenic
1022899939 7:34797412-34797434 CTCTGTGTATGGGGGACAGGGGG + Intronic
1023145405 7:37146101-37146123 CTCTGTGGTTGGGAGCCAGGCGG + Intronic
1025850661 7:65240350-65240372 GTGTGTATATGGGGGACAGTTGG + Intergenic
1026150405 7:67783552-67783574 CTCTCTGAATGGGTGGCAGGGGG + Intergenic
1028237345 7:88378519-88378541 ATAGGTTTATGGGGGACAGGTGG + Intergenic
1029360592 7:100085859-100085881 CTCTTTGTAGGGGTGGCAGGAGG + Intergenic
1030469854 7:109950273-109950295 CTCTTTGTAGGGGAGACTGGAGG + Intergenic
1031103213 7:117507609-117507631 CTCTGTGTGTGAGAGAAAGGTGG + Intronic
1032155808 7:129466795-129466817 CTTGGAGTATGGGGGAAAGGGGG - Intronic
1032198000 7:129800317-129800339 CTTTGGCTTTGGGGGACAGGTGG - Intergenic
1032847408 7:135763299-135763321 CTTTCTATCTGGGGGACAGGAGG + Intergenic
1033945595 7:146713862-146713884 CTCTGTGGATAGGAAACAGGAGG - Intronic
1035137008 7:156713474-156713496 CTCTGCATGTGGGGGACAGGAGG + Intronic
1035644395 8:1206998-1207020 CTGTGTGTGGTGGGGACAGGAGG - Intergenic
1039737109 8:40344820-40344842 CTCTGTGCATGTGGGGCTGGTGG + Intergenic
1040057714 8:43074892-43074914 TTGTGGGTATGTGGGACAGGTGG - Intronic
1041204709 8:55487175-55487197 CTCTGGACCTGGGGGACAGGTGG + Intronic
1041344274 8:56879821-56879843 GTCTGTGTATGGGGGACTGGTGG + Intergenic
1041515301 8:58692690-58692712 CACTGTGTGTTGGGGGCAGGGGG - Intergenic
1042961547 8:74308881-74308903 CTCTGAGTATGGGGGAGGAGGGG + Intronic
1045191980 8:99892679-99892701 CTCAGTATATGGGGGGCGGGGGG - Intronic
1045474522 8:102541795-102541817 CTCTGTGTATGTGTGGGAGGAGG + Intergenic
1046467638 8:114627299-114627321 TTCAGTTTTTGGGGGACAGGTGG - Intergenic
1047599472 8:126411733-126411755 GTGTGTGTATGGGGGATAGAGGG + Intergenic
1047996314 8:130339940-130339962 CTCTGTGTATGGTGGAAGTGAGG - Intronic
1048277005 8:133074200-133074222 GTATGTGTATGGGGAAAAGGAGG - Intronic
1048646092 8:136421442-136421464 CTCTGTTTGGAGGGGACAGGTGG + Intergenic
1051553444 9:18356125-18356147 TTCAGTGGATGGGGGACATGGGG + Intergenic
1054865191 9:69993102-69993124 CTCTGCATTTGGGGGCCAGGAGG - Intergenic
1056764302 9:89435504-89435526 CTCTGTGAGTTGGGGAAAGGAGG - Intronic
1057272439 9:93658572-93658594 GTCTGTGGGTGGGGGACAGATGG + Intronic
1057873744 9:98737116-98737138 ATGTGTGTATAGGGGGCAGGGGG - Intronic
1058040369 9:100295573-100295595 CTGTGGTTATAGGGGACAGGTGG + Intronic
1058983237 9:110189368-110189390 CTCTGCTGATGGGGGAAAGGAGG - Intergenic
1060412281 9:123407719-123407741 CTCTGTTCAAGGGGGACTGGAGG + Intronic
1060824365 9:126679501-126679523 GTGGGTGGATGGGGGACAGGTGG + Intronic
1060876810 9:127089832-127089854 CTCTGTGGCAGGAGGACAGGGGG + Intronic
1061473513 9:130846517-130846539 TTCAGTGTGGGGGGGACAGGAGG - Intronic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1062373984 9:136253803-136253825 CCCTGTGGATGGAGGACGGGAGG + Intergenic
1062437589 9:136553442-136553464 CTCAGTGTAGGGGGGGAAGGGGG + Intergenic
1062443148 9:136582482-136582504 CTCTGTGTCTGGTGTACAGCTGG - Intergenic
1062507971 9:136887492-136887514 CTCGGTGTAGGGCCGACAGGGGG + Intronic
1186167244 X:6839895-6839917 TTGTGTGTATGGGGGAGGGGGGG - Intergenic
1187230225 X:17414846-17414868 CTCTGTGGAAGGGGGCAAGGAGG - Intronic
1188695804 X:33189290-33189312 CTCTAGGTATGGGGGAGAGGTGG + Intronic
1189297701 X:39930363-39930385 CTCTGTGTGTGCTGGACAGATGG + Intergenic
1189451885 X:41142138-41142160 CCCTGTGTTAGGGGGTCAGGTGG + Intronic
1190154939 X:47982762-47982784 CCTGGTGTATGGGGGACAGCGGG + Intronic
1192210793 X:69126572-69126594 CACTGTGGGTGGGGGGCAGGGGG - Intergenic
1193411262 X:81166010-81166032 CTCTCTGTGTGGGGGAGATGGGG + Intronic
1195067662 X:101252324-101252346 CTTTGTTTAAGGGAGACAGGAGG - Intronic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1198234407 X:134723428-134723450 CTCTGAGTATCTGGGACAGTAGG + Intronic
1198778523 X:140207907-140207929 ATATGTGTATGGTGGGCAGGAGG + Intergenic
1198867685 X:141142056-141142078 TTCTGTGTATTGTGGAAAGGAGG - Intergenic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1200425458 Y:3015611-3015633 ATGTGTGTGTGGGGGACAGGGGG + Intergenic