ID: 1022902365

View in Genome Browser
Species Human (GRCh38)
Location 7:34823835-34823857
Sequence GAGCCCTCTGGGGGTCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022902365_1022902377 18 Left 1022902365 7:34823835-34823857 CCACAGTGACCCCCAGAGGGCTC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1022902377 7:34823876-34823898 AGGGCAGATCTGGGAGCTGCTGG No data
1022902365_1022902374 9 Left 1022902365 7:34823835-34823857 CCACAGTGACCCCCAGAGGGCTC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1022902374 7:34823867-34823889 GCCTGCTCCAGGGCAGATCTGGG 0: 1
1: 0
2: 0
3: 15
4: 244
1022902365_1022902371 -2 Left 1022902365 7:34823835-34823857 CCACAGTGACCCCCAGAGGGCTC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1022902371 7:34823856-34823878 TCATTTTGCTGGCCTGCTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 180
1022902365_1022902372 -1 Left 1022902365 7:34823835-34823857 CCACAGTGACCCCCAGAGGGCTC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1022902372 7:34823857-34823879 CATTTTGCTGGCCTGCTCCAGGG No data
1022902365_1022902373 8 Left 1022902365 7:34823835-34823857 CCACAGTGACCCCCAGAGGGCTC 0: 1
1: 0
2: 3
3: 26
4: 282
Right 1022902373 7:34823866-34823888 GGCCTGCTCCAGGGCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022902365 Original CRISPR GAGCCCTCTGGGGGTCACTG TGG (reversed) Intronic
900294218 1:1940582-1940604 GAGCCCTCACGGGGCCACAGGGG - Intronic
900466808 1:2829783-2829805 GATCCCTCCCGGGGTCTCTGAGG + Intergenic
900661684 1:3787829-3787851 GAGCACTCTGTGTGTCACTGCGG - Intronic
902619057 1:17639985-17640007 CCTCCCTCTGGGGGTCATTGTGG + Intronic
903377590 1:22876467-22876489 CTCCCCTCTGGGGTTCACTGAGG + Intronic
903735701 1:25528766-25528788 CAGCCCTCTGGGAGCCATTGCGG + Intergenic
904377424 1:30090542-30090564 GAGGCCCCTGGGGGTGGCTGTGG + Intergenic
905043457 1:34978276-34978298 GAGCCCTGTGGCTGACACTGGGG + Intergenic
905633212 1:39530550-39530572 GAGCTGGCTTGGGGTCACTGGGG + Intergenic
906587378 1:46991363-46991385 CAGCCGTCTGGGGCTTACTGTGG - Intergenic
906687641 1:47772676-47772698 GAGCTCTCTGGGGGTGACCTGGG - Intronic
906792059 1:48667834-48667856 GAGCCCTAGGTGGGTCTCTGAGG + Intronic
906944576 1:50284751-50284773 GAGGCATCTGTGGGTCTCTGGGG + Intergenic
907147451 1:52248222-52248244 CAGCCTTCTGGGGGTCTCTCAGG - Intronic
908382974 1:63613833-63613855 TAGCCCTTTGGGAGTCACTTGGG + Intronic
908662003 1:66446854-66446876 GAGCTGTCTGAGGGTCACTTTGG - Intergenic
910739698 1:90501553-90501575 GAGGGCTCTGGAGGTCACGGAGG + Intergenic
912481552 1:109985256-109985278 GGGACTTCTGGGGGTGACTGGGG + Intronic
912548857 1:110471323-110471345 GAGCCCTCTGCAGGACAATGAGG - Intergenic
913197100 1:116466211-116466233 AAGCCCTCTTGGGGCCTCTGAGG - Intergenic
913987130 1:143575330-143575352 GAGCCCACTGTGGGGGACTGAGG - Intergenic
915003364 1:152613865-152613887 GAGCTCTTTGGGGGGCACTTGGG - Exonic
915534678 1:156528176-156528198 GGGCCCTCTGGGAGTGACAGAGG - Intronic
921185316 1:212665301-212665323 AAGCCCCCTGGGACTCACTGCGG + Intergenic
923993424 1:239465238-239465260 GTGCTCTCTGGGGGTAAGTGAGG + Intronic
924359312 1:243219830-243219852 GAGCCCTCTGCTAGGCACTGTGG + Intronic
1062996415 10:1870803-1870825 GGGCCCTGGGGGGATCACTGAGG + Intergenic
1063278858 10:4602434-4602456 CAGCCATGTGGGGCTCACTGCGG - Intergenic
1064356543 10:14624059-14624081 GAGCCCTTTAGGGGTCAGTACGG - Intronic
1065170157 10:23018993-23019015 CAGCCCTCTGGGAGGCAGTGGGG - Intronic
1068603402 10:58979003-58979025 TAGCCCTCGTGTGGTCACTGAGG + Intergenic
1069854803 10:71434216-71434238 GAACCAGCTGAGGGTCACTGGGG - Intronic
1070647462 10:78211574-78211596 GAGCGCTTTGGGGGAAACTGAGG + Intergenic
1072660758 10:97362150-97362172 AAACCCTCTGGGGGTCTCAGTGG + Intronic
1074867073 10:117550897-117550919 GAGACAGCTGGTGGTCACTGAGG - Intergenic
1076011952 10:126995908-126995930 GATCCCTATTGGGGTCAGTGGGG + Intronic
1076823981 10:132958094-132958116 CAGGCCCCCGGGGGTCACTGCGG + Intergenic
1077114013 11:874983-875005 GAGCCCTGTGGGGGCTCCTGAGG - Intronic
1077184110 11:1228820-1228842 GAGCGCCTTGGGGGCCACTGGGG + Intronic
1077369193 11:2173680-2173702 GAGGCCTTTGGGGAACACTGTGG - Intergenic
1077391238 11:2301526-2301548 GAGCCTTCTTGGGGCCACAGGGG - Intronic
1077392142 11:2305035-2305057 GACCACTCTGGGGGTCCCTGAGG + Intronic
1077910818 11:6570263-6570285 GGGTCCTCTGGGGGACACTGAGG + Exonic
1078084583 11:8225962-8225984 TAGCCCTGTGGGAGTCCCTGGGG - Intronic
1078710287 11:13784479-13784501 TAGAACTCTGGGGGTCACTGAGG + Intergenic
1078718417 11:13861067-13861089 CAGATCTCTGGGGGTCACAGAGG + Intergenic
1080774503 11:35373115-35373137 GAGCCATGTGTGGGGCACTGGGG + Intronic
1081683605 11:45026172-45026194 GAGACCTCTGGGAGTCTCTCAGG - Intergenic
1082320382 11:50798920-50798942 GAGCCCTTTGTGGCCCACTGTGG - Intergenic
1084603009 11:70157528-70157550 GCCCCCACTGGGGGTCACTTTGG - Intronic
1087276632 11:96167394-96167416 GACACCTCTGGGGGCCAGTGTGG - Intronic
1089689959 11:120181007-120181029 GGGACCTCTGGTGGTGACTGAGG - Intronic
1089699361 11:120235197-120235219 GCGCCCTCTCGTGGTCACAGGGG - Intergenic
1089967421 11:122664889-122664911 CTGCCCTCCGAGGGTCACTGTGG - Intronic
1090267040 11:125359729-125359751 TAGCCCTCAAGGGGCCACTGAGG - Intronic
1090716840 11:129438654-129438676 GGGCCTTCTGGGTGCCACTGGGG + Intronic
1090913485 11:131142178-131142200 GTGGGCACTGGGGGTCACTGAGG + Intergenic
1092132027 12:6119402-6119424 GAGCCCTGGGGAGGTCAGTGTGG - Intronic
1096333331 12:50733844-50733866 TAGCCCTCTTGCTGTCACTGTGG + Intronic
1099933408 12:89099075-89099097 GAGCCTTCTGGCTGCCACTGTGG - Intergenic
1102050211 12:109856543-109856565 GAGCCTGCTGGGGGTCAGTGAGG - Intronic
1103436327 12:120929588-120929610 GACCCCTCTGAAGGGCACTGTGG + Intergenic
1103918956 12:124389638-124389660 GAGCCCTCTGTCGGGGACTGTGG + Intronic
1104974764 12:132547569-132547591 ATCCCCTCAGGGGGTCACTGGGG + Intronic
1105039887 12:132954184-132954206 AAGCCCTGTGGGAGTCACTGAGG - Intronic
1105437881 13:20392232-20392254 GGCCCCTCTGCGGGTCGCTGGGG - Intergenic
1106297501 13:28429924-28429946 GAGCTCTCTGGGGCTGTCTGAGG + Intronic
1108421239 13:50251961-50251983 GGGCCCTCAGGAGGTCTCTGAGG + Intronic
1109556000 13:63976447-63976469 GATCTCTGTGGGGCTCACTGTGG - Intergenic
1111962365 13:94825629-94825651 AAGCCTTCTGGGGGTCAGGGAGG - Intergenic
1113065973 13:106374765-106374787 GACCCCTCTGGTTGTCACTGTGG + Intergenic
1113861284 13:113489387-113489409 GTGACCTTTAGGGGTCACTGCGG - Intronic
1113949635 13:114064828-114064850 GAGCCCTCGGGCGGTGAGTGGGG - Intronic
1114189371 14:20429226-20429248 GAGCCCTATGGGGGTACCTCGGG - Exonic
1117206132 14:53445669-53445691 CAGCCCTCTGTGGGGCATTGAGG + Intergenic
1117325245 14:54662839-54662861 GACCTCTCTGGGGGTCAACGTGG - Intronic
1117834376 14:59787185-59787207 AAGCCCTCTGTGACTCACTGTGG + Intronic
1118055415 14:62074538-62074560 AAGCCATCAGAGGGTCACTGTGG - Intronic
1119321992 14:73737710-73737732 GAGACCACTGGGAGCCACTGTGG - Intronic
1119970168 14:78961398-78961420 GACCCCTCTGGTAGCCACTGGGG + Intronic
1121051161 14:90819826-90819848 GAACCCTCTGGGCTTCACCGTGG + Intergenic
1121071795 14:91030083-91030105 GAGCCTTTTGGGGTTCTCTGGGG - Intronic
1121253021 14:92513659-92513681 GAGCCCCCTGGGGCACACGGAGG - Intergenic
1122790147 14:104180948-104180970 CCGCCCTCTGAGGGTCCCTGGGG + Intergenic
1122815878 14:104313776-104313798 GAGCACCCTGAGGGTCCCTGAGG + Intergenic
1122985407 14:105209461-105209483 GAGGCCCCTGGGGGTCAGTGAGG + Exonic
1123475741 15:20591842-20591864 GGGGTCTCTGGGGGTCACTGTGG + Intergenic
1123642270 15:22408521-22408543 GGGGTCTCTGGGGGTCACTGTGG - Intergenic
1123804208 15:23854671-23854693 GGGGCCTCTGGTGGTCACAGAGG - Intergenic
1127377571 15:58398993-58399015 AGGCCCTCTGGGGGACCCTGAGG + Intronic
1129261565 15:74371063-74371085 GAGGCCTCTGGAGGGCACCGGGG + Intergenic
1130580704 15:85134839-85134861 CAGGCCTCTGGGTGTCACTCTGG + Intronic
1130580798 15:85135361-85135383 CAGCCCTCTGGGGGTCACTCTGG - Intronic
1130808418 15:87351527-87351549 GAACAGTCTGGGGGTCATTGTGG - Intergenic
1132200906 15:99954182-99954204 GAGCCTTCTGGAGGTCAAGGAGG + Intergenic
1132660131 16:1057637-1057659 GCGCCCTCTGGTGGGCACAGTGG - Intergenic
1132678475 16:1130355-1130377 GCAGCCTCTGGGGGTCTCTGAGG - Intergenic
1132793935 16:1709205-1709227 GAGCACATTGGGAGTCACTGTGG - Intronic
1132839864 16:1973746-1973768 GAGCCCCCTGGCTCTCACTGGGG + Intronic
1135396607 16:22136487-22136509 GTGCCCTCTGTCCGTCACTGTGG - Intronic
1135935314 16:26774956-26774978 AATCCCACTGGGGGACACTGGGG - Intergenic
1136686263 16:31996504-31996526 GAGCCCTCTGCTGGCCACTCTGG - Intergenic
1136786876 16:32940033-32940055 GAGCCCTCTGCTGGCCACTCTGG - Intergenic
1136882895 16:33913756-33913778 GAGCCCTCTGCTGGCCACTCTGG + Intergenic
1137081836 16:36071353-36071375 GAGCCCTTTGAGGGCTACTGTGG + Intergenic
1138250990 16:55501765-55501787 GAGCCCCCTAGGAGGCACTGTGG + Intronic
1138380731 16:56600584-56600606 ATGCCCTCTGCTGGTCACTGGGG + Intergenic
1138513083 16:57519935-57519957 GCGCCCTCTGGTGGCCATTGAGG + Intronic
1139245868 16:65443013-65443035 GAGCCATCTGGGGGATTCTGGGG + Intergenic
1139852643 16:69960299-69960321 GAGGCCTCTGGGGGGCAGCGTGG + Intronic
1139881614 16:70183207-70183229 GAGGCCTCTGGGGGGCAGCGTGG + Intronic
1140061917 16:71577969-71577991 GAGCCCTGGGGAGATCACTGAGG - Intergenic
1140370894 16:74412298-74412320 GAGGCCTCTGGGGGGCAGCGTGG - Intronic
1141476237 16:84275298-84275320 GAGCCTTCTGGGGTGCCCTGGGG - Intergenic
1203089112 16_KI270728v1_random:1201703-1201725 GAGCCCTCTGCTGGCCACTCTGG - Intergenic
1142631495 17:1229186-1229208 GAGCCGCCTGGGGGTCCCCGAGG + Intergenic
1143550900 17:7629975-7629997 CACCCCTCTGGGGATCAATGGGG - Intronic
1144572494 17:16408192-16408214 GTGGCCTCTGGGGCTCCCTGGGG + Intergenic
1144673838 17:17148289-17148311 TAGACCTCTGGGGGTCCCTGAGG + Intronic
1145011021 17:19367971-19367993 GAGCACTCTGGGGGGCCCTGAGG + Intronic
1147018092 17:37508375-37508397 CAGCCCTCTGGGGGATTCTGAGG + Intronic
1147560839 17:41507937-41507959 GAGGGCTCTGGGATTCACTGCGG - Intergenic
1148650097 17:49244216-49244238 GAGCATTGTGGGGGTCAGTGGGG + Intergenic
1151477330 17:74351590-74351612 GAGCCCTGAGGGGGTCACATGGG + Intronic
1152014912 17:77744277-77744299 GGGCCCTCATGGGGTCCCTGGGG + Intergenic
1152411252 17:80124471-80124493 AAGCCCTCTGGCGGCCACTGTGG + Intergenic
1152444971 17:80337205-80337227 GAACCCTCTGGGGGTGACGCTGG - Intronic
1152806102 17:82357112-82357134 GAGCCCTCTGAGGGCCCCTGTGG - Intergenic
1154205622 18:12334395-12334417 GAGCCCTCTGTGAGGCACTGAGG - Intronic
1155022859 18:21912527-21912549 GCAGCCTGTGGGGGTCACTGTGG + Intergenic
1157535335 18:48453333-48453355 GAGACCTCTGGGGTTGTCTGAGG + Intergenic
1157588629 18:48820991-48821013 CAGCTCTCTGGGAGTCCCTGGGG + Intronic
1157600863 18:48892431-48892453 GAGCTCCCTGGGGCTCTCTGAGG + Intergenic
1158965224 18:62616696-62616718 GAGACTTCCGGGGGTCACTCTGG - Intergenic
1159871765 18:73766704-73766726 GAGGCCCCTGGGGATCTCTGTGG + Intergenic
1160034618 18:75288476-75288498 GGGCCCACTGGGGGCCACCGAGG + Exonic
1160364323 18:78311574-78311596 GTGCCCTCTGAGGGTCACACTGG - Intergenic
1160426402 18:78781938-78781960 GAGCCCTCTGGTCATCACAGAGG + Intergenic
1160426682 18:78782891-78782913 GAGCCCTCTGGTCATCACAGAGG + Intergenic
1160717302 19:582181-582203 GCCACCCCTGGGGGTCACTGAGG + Intronic
1161009088 19:1951502-1951524 GTGTCCTCTGGGGCTCCCTGAGG + Intronic
1161010347 19:1956828-1956850 GAGCCTCCTGGGGCTCTCTGGGG - Intronic
1161041893 19:2114767-2114789 GAGCCCTGTAGGGGTCGTTGGGG + Exonic
1161495386 19:4583511-4583533 CTGCCCGCTGGGGGCCACTGAGG + Intergenic
1162738604 19:12760730-12760752 GCGCCCTCTGGTGGCCACTCTGG - Intergenic
1162914959 19:13869642-13869664 GAGCCCTGTGGGGGTCTCCGTGG - Intronic
1162937361 19:13987821-13987843 GAACTCTCTGGGGCTCACTTTGG - Intronic
1162967094 19:14161167-14161189 GAGAGCTCTGCTGGTCACTGGGG + Intronic
1163251004 19:16126283-16126305 CAGCCCTCTCAGGGTCACTGGGG - Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1163592632 19:18203035-18203057 GAGCCCGGAGGGGGTGACTGCGG + Intronic
1163664703 19:18597907-18597929 GATCCTTCTGGGGGCCCCTGAGG + Intronic
1164346065 19:27259319-27259341 GAGCACTTTGAGGGTTACTGTGG + Intergenic
1164908624 19:31987530-31987552 GAGCCATTTGGGGCTAACTGAGG + Intergenic
1165770346 19:38376313-38376335 GAGCTCTCAGGAGGTGACTGAGG - Intronic
1165829250 19:38722413-38722435 CAGACCTTTGGGGGTGACTGTGG - Intronic
1166097452 19:40549814-40549836 GAACCCTCTGGGGCACAATGGGG - Intronic
1166141153 19:40806116-40806138 GAGCCCCCTGGGGAGCTCTGAGG - Intronic
1166267207 19:41691568-41691590 CTGCCCTCTGGGGGACAATGAGG + Intronic
1166294140 19:41880790-41880812 GTTCCCTCTGGGGGTGGCTGGGG + Intronic
1166408681 19:42541836-42541858 GGGCCCTCTGGTGGACAGTGAGG + Intronic
1167114543 19:47480910-47480932 GAGCCCTGTGGGATTCACTGTGG - Intronic
1167363955 19:49044897-49044919 GAGACCTGTGGGGGCAACTGGGG + Intronic
1168249883 19:55135865-55135887 AAGCCCTCTGGGGGGCGCTGTGG - Intronic
925661426 2:6207392-6207414 GCGCTCTCAGGGGTTCACTGTGG - Intergenic
929310822 2:40422068-40422090 GAGCCCGCTGAGGGTCCCAGTGG - Intronic
932413075 2:71558636-71558658 GAGCCCTGCAGAGGTCACTGAGG - Intronic
935277413 2:101486875-101486897 GGGCTCTCAGGGTGTCACTGGGG + Intergenic
941772682 2:169361804-169361826 GCGGTCTCTGGGGGTCACCGCGG + Intronic
942227714 2:173831654-173831676 CAGGCCTGTGGGTGTCACTGAGG - Intergenic
945063158 2:205925877-205925899 CAGCCCTCTGGGTGTCTCTCGGG - Intergenic
945814830 2:214591551-214591573 GAGCCCTCTGGAGGTCACTTGGG + Intergenic
945875106 2:215270027-215270049 GTGCCCTCTAGCGGTCAGTGTGG + Intergenic
945936169 2:215904725-215904747 GAGCCCACTGGGAGGCACCGGGG - Intergenic
946110731 2:217413016-217413038 GAGCCAGCTGGGGCTAACTGAGG + Intronic
946488617 2:220126008-220126030 GTCCCCTCTGGGGTTGACTGGGG - Intergenic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
947810795 2:233002915-233002937 AAGCCCCCTGGGGGACTCTGAGG + Intronic
947858016 2:233337584-233337606 GAGCTCTCTGGGGAGCACTGTGG + Intronic
948264835 2:236628799-236628821 GAGTCCTCTGCCTGTCACTGGGG - Intergenic
948904024 2:240969291-240969313 CAGCCCTCTGGTGGCCTCTGAGG - Intronic
1170162220 20:13325118-13325140 GCACCCTCTGGTGGTCACTTAGG - Intergenic
1170401816 20:15993981-15994003 GAGATCCCTGGGTGTCACTGGGG - Intronic
1171230106 20:23477371-23477393 GAGCCCTCTGTGTGTGGCTGAGG + Intergenic
1171267338 20:23782549-23782571 CTTCCCTCTGGTGGTCACTGTGG - Intergenic
1171280196 20:23889871-23889893 CTTCCCTCTGGTGGTCACTGTGG - Intergenic
1171739426 20:28862015-28862037 GAGCGCTTTGGGGCTTACTGTGG + Intergenic
1171758558 20:29144312-29144334 GAGCGCTTTGGGGCTTACTGTGG + Intergenic
1171761224 20:29197096-29197118 GAGCGCTTTGGGGCTTACTGTGG + Intergenic
1171821734 20:29852824-29852846 GAGCCCTTTGGGGGCTACTGTGG + Intergenic
1171981920 20:31634412-31634434 GCGCCCTCTGCTGGTCACTCTGG - Intergenic
1172186018 20:33031540-33031562 GAGCCCCCTGGGTGTTTCTGGGG - Intergenic
1173599510 20:44283336-44283358 GAGGCCTCTGGTGTTGACTGAGG + Intergenic
1176861186 21:14012373-14012395 GAGGCATTTGGGGCTCACTGTGG + Intergenic
1178384067 21:32135161-32135183 TAATCCTCTGGGGGTGACTGTGG - Intergenic
1178859758 21:36278971-36278993 GAGCCCACTGGGTGACCCTGGGG + Intronic
1179107524 21:38416314-38416336 GATCCCTTTTGGGGCCACTGGGG - Intronic
1179446551 21:41435893-41435915 GAGCCCGCAGGGAGTCAATGAGG - Exonic
1179784014 21:43719572-43719594 GAGCGCTCTGCGGGCCCCTGCGG + Intronic
1180506128 22:16006980-16007002 GAGCCCTTTGAGGCTTACTGTGG - Intergenic
1181173119 22:21021411-21021433 GGCCCCACTGGTGGTCACTGTGG + Intronic
1181510989 22:23388628-23388650 GCGCCCCCTCGGGGCCACTGGGG + Intergenic
1181559691 22:23692863-23692885 GAGGACTCTGGGGCTGACTGTGG - Exonic
1182712708 22:32332548-32332570 GGGCCTTCTGGGAGTCTCTGAGG + Intergenic
1182943292 22:34298717-34298739 CAGCCATCTGGTGGTAACTGGGG + Intergenic
1183281411 22:36934676-36934698 GAGTCGCCTGGTGGTCACTGTGG - Intronic
1184088449 22:42279946-42279968 GTGCCCTCTGGGGGCCTCTGGGG + Intronic
1184271883 22:43389024-43389046 GGGGCCTCTGGGGGCCTCTGGGG - Intergenic
1184728868 22:46362303-46362325 GAGCCCTGCTGAGGTCACTGTGG - Exonic
1185366397 22:50438854-50438876 GAGGCATTTGGGGCTCACTGTGG + Intronic
1203332527 22_KI270739v1_random:15067-15089 GAGCCCTTTGAGGCTTACTGTGG + Intergenic
949867559 3:8558978-8559000 CAGCCCTCTAGGGGATACTGAGG + Intronic
950193178 3:10992145-10992167 TCGCCCTCTGTGGGTCGCTGTGG - Intergenic
950460580 3:13119982-13120004 GAGCTCTCTCTGGGTCCCTGTGG - Intergenic
950663170 3:14479544-14479566 GAGCTCTGTTTGGGTCACTGGGG + Intronic
952416755 3:33096878-33096900 GAGCCTGCTGGGGGGCACTTCGG + Intronic
952754118 3:36851134-36851156 GAGGTCACTGGGGGTCAATGTGG + Intronic
953069973 3:39509844-39509866 GACCCTGCTGGGGGTCCCTGGGG - Intronic
953193733 3:40713089-40713111 GAGTCCTCTGAGGGTCAGAGAGG - Intergenic
953215462 3:40913876-40913898 GAGGCCTCTGAGGTTCAGTGAGG - Intergenic
954127308 3:48539091-48539113 TCGCCCTCTGTGGATCACTGTGG - Intronic
954148005 3:48643806-48643828 GAGGTCTCTGGAGGACACTGGGG + Intronic
954223960 3:49171177-49171199 GCGCCCCCTGGAGGCCACTGGGG - Intergenic
955524910 3:59809955-59809977 GATCCCTCTGGTGGTTACTAGGG + Intronic
958553567 3:95645537-95645559 GAGCCCACTGGAGCTCAATGAGG + Intergenic
961093819 3:124138036-124138058 CAGCCTGCTGGGGGCCACTGGGG - Intronic
961352772 3:126314612-126314634 GGGCCCTGCTGGGGTCACTGTGG - Intergenic
961649771 3:128411514-128411536 GTGCCCTCTGGGGTCCTCTGTGG + Intergenic
966681213 3:182643798-182643820 GAGCCCTCTGGGCTTCATTCTGG + Intergenic
966917259 3:184591994-184592016 GAGCCCTCTGGTGGGGGCTGGGG - Intronic
967731879 3:192914767-192914789 GAGCTTGCTGGTGGTCACTGTGG - Intronic
968045718 3:195623082-195623104 GGACACTATGGGGGTCACTGCGG - Intergenic
968064431 3:195750847-195750869 GGACACTATGGGGGTCACTGCGG - Intronic
968308938 3:197667005-197667027 GGACACTATGGGGGTCACTGCGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968698822 4:2045257-2045279 GTGCCCTCTGGGATTCAGTGGGG + Intergenic
968910077 4:3473077-3473099 GAGCCCCCTGGGCCACACTGAGG - Intronic
969609983 4:8222111-8222133 GGGCACTCTGGGGAGCACTGAGG + Intronic
969665499 4:8554931-8554953 CAGCACCCTGGGGGTCGCTGGGG - Intergenic
973619694 4:52713900-52713922 AAGCCCTCTGGGTGGCACGGGGG + Intergenic
975929224 4:79498187-79498209 GAGCCTTCTAGAGGTGACTGGGG - Intergenic
978476457 4:109136735-109136757 GCACCAGCTGGGGGTCACTGAGG - Intronic
983689698 4:170453242-170453264 GAGACTTCTGGTGGTGACTGAGG - Intergenic
985776792 5:1848538-1848560 GAGCACTCTGGTGTTCACTTTGG + Intergenic
985801652 5:2008369-2008391 GATCCCTCCGGAGCTCACTGGGG + Intergenic
985923561 5:2998386-2998408 CAGCCCAATGGGGGTGACTGGGG + Intergenic
986380541 5:7181042-7181064 TAGCCCTCTGGAGGACCCTGAGG - Intergenic
989943620 5:50187889-50187911 GAGCCCTTTGCGGCTCATTGTGG - Intergenic
992760466 5:79947044-79947066 GAGGCCCAGGGGGGTCACTGAGG + Intergenic
999400934 5:151263747-151263769 GAGCACTCTTGGGGTCCATGGGG + Intronic
1001841767 5:174882305-174882327 GAGCTTTCTTGAGGTCACTGGGG - Intergenic
1002426958 5:179182156-179182178 GAGCCCTCTGTGTGCCCCTGTGG + Intronic
1002428779 5:179191296-179191318 GAGCCCTGGGGGGCTCAGTGAGG + Intronic
1003679304 6:8236284-8236306 GAGCCCACTGAGGGTCCCAGGGG - Intergenic
1006058394 6:31402522-31402544 GAGCACTCTGGTTGTAACTGAGG + Intronic
1006070834 6:31497065-31497087 GAGCACTCTGGTTGTAACTGAGG + Intronic
1006151374 6:31991959-31991981 GAGCCCTCTGGGTGGGGCTGGGG + Intronic
1006157675 6:32024697-32024719 GAGCCCTCTGGGTGGGGCTGGGG + Intronic
1006636907 6:35467681-35467703 AAGGGCTCTGGGGGTTACTGTGG + Intergenic
1006753662 6:36396318-36396340 GAGCTCCCTGGGTGCCACTGTGG + Intronic
1006774117 6:36578523-36578545 GAGCACTCTGGAGGGCACTAAGG + Intergenic
1007061817 6:38947593-38947615 GAGGCCTGTGGGGGACACTGTGG + Intronic
1007914288 6:45546596-45546618 AAGCCCTCTGGGATTCTCTGGGG + Intronic
1008340098 6:50353766-50353788 GAGCCATCTGGTGGTGGCTGTGG - Intergenic
1013007790 6:106090178-106090200 GGCCCCTCTTGGTGTCACTGTGG + Intronic
1013661407 6:112300404-112300426 GATCCCTCTGATGGTCACTTTGG + Intergenic
1014142889 6:117964636-117964658 GAGCACTCTGGAGGACCCTGAGG + Intronic
1015118759 6:129678171-129678193 CAGACCTCTGGGGTTCAATGGGG - Intronic
1015970056 6:138734691-138734713 GAGCCCACTGGGACTGACTGAGG + Intergenic
1018924221 6:168195158-168195180 CAACCCTCAGGAGGTCACTGAGG - Intergenic
1020125738 7:5531594-5531616 GAGGCCGCTGGGGGACTCTGGGG + Intronic
1021215960 7:17915366-17915388 CAGCCCCCTGGGCGGCACTGGGG + Intronic
1021585136 7:22199620-22199642 GAGCCCTTTGTGGCTCCCTGGGG - Intronic
1022902365 7:34823835-34823857 GAGCCCTCTGGGGGTCACTGTGG - Intronic
1026772758 7:73212645-73212667 GGTCCCTCTGGGACTCACTGAGG - Intergenic
1027013622 7:74766045-74766067 GGTCCCTCTGGGACTCACTGAGG - Intergenic
1027074416 7:75179988-75180010 GGTCCCTCTGGGACTCACTGAGG + Intergenic
1029348214 7:99993894-99993916 CAGCCCTCTGGGGGTCGAGGCGG + Intergenic
1029404924 7:100368985-100369007 GAGCCCTCAGGTGGCAACTGAGG + Intronic
1031012263 7:116536675-116536697 AAGCCCTCTGTGGGTCGCTGTGG - Intronic
1033619518 7:143049625-143049647 GAGCCCTCTGGGGACTTCTGAGG - Intergenic
1034272045 7:149808079-149808101 GGGCGCTGTGGGGCTCACTGAGG + Intergenic
1034881675 7:154767563-154767585 GAGGCCTGTGGAGGTCAGTGAGG - Intronic
1035021764 7:155804712-155804734 GAGCCCTCTGTCGCTCTCTGAGG + Intronic
1035383394 7:158454910-158454932 GGGCCCCCGGGGGGTCGCTGAGG - Intronic
1037671513 8:21019290-21019312 GACCCCTCTGGGTATAACTGAGG - Intergenic
1038085447 8:24191988-24192010 GACCCTTGGGGGGGTCACTGGGG - Intergenic
1038419550 8:27423675-27423697 GAGCCAGCTGAGGGGCACTGGGG + Intronic
1039593272 8:38768468-38768490 GTGCCCTCTGGTGGCTACTGCGG + Intronic
1040810927 8:51452566-51452588 GATCACTCTTGGGGCCACTGGGG + Intronic
1043609936 8:82050167-82050189 TTGCCATCTGGGGGTCACTCAGG + Intergenic
1043978740 8:86614272-86614294 GTGGGCTCTGGGGGTCAGTGGGG - Intronic
1048199281 8:132358349-132358371 ACCCCCTCTGGGAGTCACTGTGG + Intronic
1048510772 8:135060281-135060303 GATCTCTGTGGGAGTCACTGGGG + Intergenic
1048968564 8:139631043-139631065 GCGCCCTCTGGCGGGCACTCGGG + Intronic
1049873832 8:145002691-145002713 GCGTCCTCTACGGGTCACTGAGG + Intergenic
1056579137 9:87877576-87877598 GAGGTCTCTGTGGGTCTCTGGGG + Intergenic
1056581535 9:87890394-87890416 GGGGTCTCTGGGGGTCACTGTGG - Intergenic
1057280951 9:93711179-93711201 GAGCCCTGTGGGGGTAAGGGTGG + Intergenic
1057301980 9:93891818-93891840 GACCTCCCTGTGGGTCACTGTGG + Intergenic
1059424476 9:114212062-114212084 GGGCCCTCTGGGGGCCAAAGAGG + Intronic
1060159462 9:121347362-121347384 GGCCCCTCTGGGAGGCACTGAGG - Intronic
1060981971 9:127798044-127798066 TACCCCTCTGGGGGACAATGTGG + Intronic
1062050455 9:134444238-134444260 GACCCCTGTGTGGGTCAGTGGGG + Intergenic
1062336779 9:136074745-136074767 GGGCCCTCTGGGAGTCACAGGGG - Intronic
1186962483 X:14751640-14751662 AAGCCCTTTGGGGGTCTCTCAGG - Intergenic
1190333180 X:49248106-49248128 GAGGCCTGTGGGGGCCACAGGGG + Intronic
1192112947 X:68383722-68383744 GAGCTCTCTGGGGATCCCTAGGG - Intronic
1196890844 X:120289178-120289200 AAGCTCTCTGGGTGTCAATGAGG + Intronic
1199720871 X:150542059-150542081 AGGCCCTCTTGGGGCCACTGTGG - Intergenic
1199989478 X:152977831-152977853 AAGCCTTCTGTGGGGCACTGGGG + Intergenic
1200086599 X:153610235-153610257 GGGCGCTTTGGGGGGCACTGGGG - Intergenic