ID: 1022907557

View in Genome Browser
Species Human (GRCh38)
Location 7:34871568-34871590
Sequence TTTTACAGGCTGATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 2, 2: 13, 3: 29, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022907557_1022907561 12 Left 1022907557 7:34871568-34871590 CCTTCCACCATCAGCCTGTAAAA 0: 1
1: 2
2: 13
3: 29
4: 262
Right 1022907561 7:34871603-34871625 TATTTGCTTCCAAGATACAATGG 0: 6
1: 106
2: 623
3: 2345
4: 2357
1022907557_1022907562 15 Left 1022907557 7:34871568-34871590 CCTTCCACCATCAGCCTGTAAAA 0: 1
1: 2
2: 13
3: 29
4: 262
Right 1022907562 7:34871606-34871628 TTGCTTCCAAGATACAATGGTGG 0: 7
1: 286
2: 1633
3: 1996
4: 1625
1022907557_1022907564 27 Left 1022907557 7:34871568-34871590 CCTTCCACCATCAGCCTGTAAAA 0: 1
1: 2
2: 13
3: 29
4: 262
Right 1022907564 7:34871618-34871640 TACAATGGTGGCACAAGCATTGG 0: 1
1: 21
2: 169
3: 1088
4: 2198
1022907557_1022907565 28 Left 1022907557 7:34871568-34871590 CCTTCCACCATCAGCCTGTAAAA 0: 1
1: 2
2: 13
3: 29
4: 262
Right 1022907565 7:34871619-34871641 ACAATGGTGGCACAAGCATTGGG 0: 1
1: 14
2: 133
3: 939
4: 1931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022907557 Original CRISPR TTTTACAGGCTGATGGTGGA AGG (reversed) Intronic
901089770 1:6633465-6633487 CTGTCCAGGCTGATGGAGGAGGG - Exonic
902983681 1:20142696-20142718 TATTACAGGCTGATACTGGCTGG - Intronic
903198725 1:21714683-21714705 TTTTACAAGATGATCGTGCAAGG - Intronic
903378476 1:22881027-22881049 TTTGAGAGGCTGATGCAGGAGGG + Intronic
904300009 1:29548164-29548186 GATTACATGCTGAGGGTGGAGGG + Intergenic
904770137 1:32876540-32876562 TTTTAGAGGCTCAGAGTGGAAGG + Intergenic
904792046 1:33030033-33030055 TTTTAGAAGTTGATTGTGGAGGG - Intronic
905250615 1:36645947-36645969 TTTGACGGGCTGTCGGTGGATGG - Intergenic
905722795 1:40220881-40220903 TTTGAGAGGCTGAGGGAGGAGGG + Intronic
905845534 1:41228116-41228138 TTTTACAGGGTCATGCTGGAGGG + Intronic
906856545 1:49312367-49312389 TTTTAGGGGCTGATAGTTGAAGG - Intronic
907338732 1:53718393-53718415 TTTGACAGACTGATGGAGTATGG + Intronic
907532128 1:55109852-55109874 TTTTAAAGGTTGATTGTTGAAGG - Intronic
908648824 1:66309985-66310007 TTTTCCAGGCTGATGATAGCAGG + Intronic
908766780 1:67561377-67561399 TTCTACAGGCTCATTGTGGCAGG + Intergenic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
910721142 1:90287412-90287434 TCTTCCAGGCTGAAAGTGGAAGG - Intergenic
911530284 1:99036221-99036243 TTTTACAGGCTCAAGGTGGAAGG - Intergenic
912154143 1:106896571-106896593 TTTTACGGGCTGGTGGCAGAAGG + Intergenic
912175019 1:107143848-107143870 TTTTGCAGGATGATTGAGGATGG - Intronic
912234144 1:107830569-107830591 TTTTATAGGGTCATGCTGGAGGG - Intronic
915297077 1:154929043-154929065 TTTTGCAGGAAGATTGTGGAGGG - Exonic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
916955952 1:169835013-169835035 TGTTACAGGATGAATGTGGAAGG + Intronic
917021303 1:170591116-170591138 TTCTACATGCTGCTGTTGGAAGG - Intergenic
917531003 1:175834923-175834945 TGTTACAGGGTCATGATGGAGGG - Intergenic
918444390 1:184602258-184602280 TTTCACATGCTGGTGGTGGGAGG + Intronic
920589385 1:207202371-207202393 TTCTACAGGGTCATGCTGGAGGG + Intergenic
920612908 1:207459159-207459181 TTATACAGGCAGATGCCGGAAGG + Intronic
921594246 1:217037747-217037769 TTTTACAGGCTCTTGGTGGAAGG - Intronic
921919325 1:220648596-220648618 TTTCAAAGGCTGATGGTGAATGG - Intronic
922651579 1:227344435-227344457 TTCTACAGTCTTATGGGGGAGGG - Intergenic
923959155 1:239057216-239057238 TTTTATAGGATCATGCTGGAGGG - Intergenic
924806637 1:247366686-247366708 TTTTCCAGGTGCATGGTGGAAGG - Intergenic
924934243 1:248754951-248754973 TCTTACAGTGTGATGGAGGAGGG + Intronic
1063013894 10:2055095-2055117 CATAACAGGCTGATGGTGGAAGG + Intergenic
1063227062 10:4025566-4025588 TTTAACAGGCTGTTAGTGGAGGG + Intergenic
1064873638 10:19968236-19968258 TTGTTCAGGTTTATGGTGGAAGG + Intronic
1066154850 10:32664499-32664521 TATAAGAGGCTGATGGTGGGAGG - Intronic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1069841580 10:71342806-71342828 TTTCTCAGGCTCATGGTTGACGG + Intronic
1069858766 10:71457138-71457160 TTTGATAGGCTGAAGCTGGAGGG + Intronic
1070150685 10:73803065-73803087 TTTTAGTTGCTGATTGTGGATGG - Exonic
1071962847 10:90823506-90823528 TTTTACAGGCTCATAGTGGAAGG + Intronic
1072901055 10:99407270-99407292 TTTTAGAGGCTTATGCTAGAGGG - Intronic
1073604082 10:104876287-104876309 TTTTTCTGGCTGATGGAGGATGG + Intronic
1073681427 10:105708405-105708427 TTTTACAAATTGATGGTGCATGG + Intergenic
1074356590 10:112791042-112791064 AGTTACACCCTGATGGTGGAAGG - Intronic
1074619656 10:115106016-115106038 TTTTCCAGGCACATGGTGCAAGG - Intronic
1077477269 11:2796445-2796467 GTATAAAGGCTGAAGGTGGAAGG - Intronic
1078203213 11:9203517-9203539 TTTTGCAGGTAGGTGGTGGATGG - Intronic
1080609591 11:33892380-33892402 AAATACAGGCTGATGGTGTAGGG - Intergenic
1081828839 11:46087998-46088020 TTTGGGAGGCTGAAGGTGGATGG - Intronic
1081938768 11:46922881-46922903 ACTTACAGTCTGATGGTTGAAGG + Intergenic
1082616763 11:55370836-55370858 TTTTACAGGCTCAGGGGGAAGGG - Intergenic
1083160619 11:60852093-60852115 TTTTACCAGATGATGGGGGAGGG - Exonic
1084011648 11:66353447-66353469 TTTTACAGATTGAAGGTGGCGGG + Intronic
1086286835 11:85261188-85261210 TTTTATAGGGTCATGCTGGAGGG + Intronic
1086936004 11:92746661-92746683 TTTTACAGGCTCATAGGTGAAGG - Intronic
1088715042 11:112541777-112541799 TTTTATAGGGTCATGCTGGAGGG - Intergenic
1088734909 11:112720625-112720647 TTTTACAGGCTCATAGCGGAAGG + Intergenic
1089015774 11:115164034-115164056 GTTAACAGTCTGATGGGGGAGGG - Intergenic
1089408554 11:118219523-118219545 TTTTATAGGGTGGTGCTGGAGGG - Intronic
1089919363 11:122193818-122193840 TTTTCCAGCCTCATGGAGGAAGG + Intergenic
1091404313 12:199466-199488 TTTTGCAGGCTAATGGTTGGGGG + Intronic
1093832251 12:23776624-23776646 TTTAACAGGGGGATGGTGGAAGG + Intronic
1093957454 12:25237222-25237244 TTTTAGAGGCTGGTGGGAGAAGG + Intronic
1094208125 12:27862106-27862128 TTTTGCAGGCTGCTGGATGAGGG - Intergenic
1094501812 12:31028330-31028352 TTTTAGAGGCTGAGGTGGGAAGG - Intergenic
1094789267 12:33891906-33891928 TTTTACTGGATGATGGTACAGGG + Intergenic
1095990841 12:48033533-48033555 GTTTTCTGGCTGATGGTGGGAGG + Intergenic
1096410391 12:51373067-51373089 TTTTACAGGCTCATAGGGGAAGG + Intronic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1097558065 12:61165882-61165904 TTTGACAGGCTCATAGGGGAAGG - Intergenic
1097932858 12:65209000-65209022 TTTTGCAGGATGCTGGAGGAGGG - Intronic
1099075414 12:78102146-78102168 TTTTACAGGCTCATAGTGGAAGG - Intronic
1099118860 12:78663028-78663050 TTTTACAGTTTGATAGTTGACGG - Intergenic
1099635295 12:85204769-85204791 TTTTACAGGCTCATAGGAGAAGG + Intronic
1100275723 12:93070090-93070112 TTTTATAGGCTGATTCTGAAAGG - Intergenic
1100276153 12:93073592-93073614 TTTCAGTGGCTGATGATGGAAGG - Intergenic
1100747391 12:97661196-97661218 TTTTGCAGGCTCAAGGTGTAAGG - Intergenic
1100971997 12:100080222-100080244 TTTTCCAGGCACATGGTGCAAGG - Intronic
1101408487 12:104450082-104450104 TCTTATAAACTGATGGTGGAAGG - Intergenic
1103122694 12:118394121-118394143 CTTTGCAGGCTGATGGTCCAGGG + Intronic
1105023463 12:132833470-132833492 TATTTCAGGCCGATGGTTGAGGG + Intronic
1106117424 13:26829642-26829664 TCCTGCAGGCAGATGGTGGAGGG + Intergenic
1106283006 13:28293557-28293579 TTTTACAGCCTGAATTTGGAGGG + Intronic
1107103111 13:36615004-36615026 TTATATAGGCTGACGGTGGCTGG + Intergenic
1108422753 13:50267385-50267407 TTTTACAGGCCGAAGCTGAACGG + Intronic
1109246872 13:59965489-59965511 TTTTACAGGCTGTTGGAAAATGG - Intronic
1109571088 13:64191317-64191339 TTTGGGAGGCTGAGGGTGGAGGG + Intergenic
1110488466 13:76073630-76073652 ACTTACAGGCTGAAGGTGAAGGG + Intergenic
1110691501 13:78434405-78434427 ATATACAGGATGATGGTGGCCGG - Intergenic
1112067965 13:95814558-95814580 TTTTACAGGCTCATAGGCGAAGG + Intronic
1112491415 13:99867839-99867861 TTCTGCTGGGTGATGGTGGAGGG - Intronic
1112826552 13:103398515-103398537 TTTTCCAGGCACATGGTGCAAGG + Intergenic
1115989915 14:39141087-39141109 TTTTACAGGCTCATGGGGGAAGG - Intergenic
1119142301 14:72278314-72278336 ATTTACAGGCTCATGGTGAGGGG + Intronic
1120810898 14:88802556-88802578 TTTAACAGGCTGACAGTGGATGG - Intergenic
1121866108 14:97364238-97364260 TTTTATAGGATCATGCTGGAGGG - Intergenic
1202927185 14_KI270724v1_random:37379-37401 TTTGAAAGGCAGATGCTGGAGGG - Intergenic
1125034712 15:35110729-35110751 TTTTACAGGTTGAAGGCTGAAGG - Intergenic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1127249847 15:57221569-57221591 ATTTCCAGGCTTATGGTAGATGG + Intronic
1127525592 15:59789752-59789774 TTTTACAGGCTCATGGTAGAAGG + Intergenic
1129093366 15:73175865-73175887 TTTTACAGGGTGACGGGGAAAGG - Intronic
1130282279 15:82529929-82529951 TTCTCCAGGCTTATGCTGGAAGG - Intergenic
1130304686 15:82705239-82705261 TTTTAAAGCCTGCTGGGGGATGG - Intronic
1130688175 15:86057286-86057308 TTAAACAGGATGATGATGGAAGG - Intergenic
1131076013 15:89495448-89495470 TTTCATTGGCTGATGGCGGATGG + Intronic
1131296540 15:91154427-91154449 TTAGACAGGCAGATTGTGGAAGG + Intronic
1132238545 15:100239901-100239923 CTTCACTGGCTGAGGGTGGAGGG - Intronic
1135289578 16:21223820-21223842 AGTTACAGGCTGCTGGTGGATGG - Intergenic
1138481343 16:57305385-57305407 TTTTCTTGGCTGAGGGTGGAGGG + Intergenic
1139374716 16:66489760-66489782 TTTTATAGGATCATGCTGGAGGG + Intronic
1139827347 16:69767655-69767677 TTTTACAGGGTTGTGCTGGAGGG + Intronic
1141036243 16:80628824-80628846 GTTTACAGTCTAATGGAGGAGGG + Intronic
1141151861 16:81569998-81570020 TTTGACAGACAGATGCTGGAGGG - Intronic
1144538427 17:16114506-16114528 TTTCACAGGCTCATAGGGGAAGG - Intronic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1150852961 17:68722706-68722728 TTTAAGAGGCTGAGGGTGGGAGG + Intergenic
1152454454 17:80405413-80405435 TTCTGCAGGCAGATGGTGGTTGG - Intergenic
1152912950 17:83015865-83015887 TTTCACAGACCGATGGTGGGGGG - Intronic
1155393285 18:25360028-25360050 ATATAAAGGCTGATGGTGGGGGG - Intergenic
1156137156 18:34056440-34056462 TTCTACAGGCAGATGCTAGAAGG - Intronic
1156817608 18:41329253-41329275 TTTTACAGGCTCATTGTGGAAGG + Intergenic
1157466357 18:47949659-47949681 TTTTAAAGGCAAATGGGGGAGGG + Intergenic
1158782785 18:60670764-60670786 TTTTATAGGGTCATGCTGGAAGG - Intergenic
1158814849 18:61083490-61083512 GTTAACAGGCACATGGTGGAAGG - Intergenic
1159215659 18:65387571-65387593 TTTTTCAGGCTCATAGAGGAAGG + Intergenic
1159265358 18:66072598-66072620 TTTTACAGGCTGATGGGTGGAGG + Intergenic
1159606364 18:70478857-70478879 TTTTACAGGCTCATGGTGGAAGG + Intergenic
1161911910 19:7200203-7200225 TTTTTCTGGCTTATGGTAGATGG + Intronic
1165974741 19:39665874-39665896 TTTTCCAGGCTCATGGTGCAAGG + Intergenic
1167239037 19:48332423-48332445 TTGCACAGGCTGCTGGTGGTGGG + Exonic
926456438 2:13073533-13073555 TTTTACAGGATGATAGGGGGAGG - Intergenic
927417514 2:22894107-22894129 TTTGACAGGCTGATAGGGAAAGG - Intergenic
927683009 2:25152466-25152488 TGTTACAGAGTGATGGGGGAGGG + Intronic
929422874 2:41812427-41812449 TCTTACTGGCTGTTGGTGGGAGG - Intergenic
929535712 2:42783133-42783155 CTTTGTTGGCTGATGGTGGAGGG - Intronic
930480685 2:51944430-51944452 TTTTGCAGGCTGTAGGTGGAAGG + Intergenic
930509316 2:52324818-52324840 TTTTACACACTGCTCGTGGAAGG + Intergenic
932127395 2:69156437-69156459 TTTTAAAGGATGAAGGTGGCTGG - Intronic
933435861 2:82249353-82249375 TTTTATAGTCTCATGCTGGAGGG + Intergenic
934788982 2:97040949-97040971 TTTAAAAGGCTGTTGGTGGCTGG - Intergenic
934817492 2:97341611-97341633 TTTAAAAGGCTGTTGGTGGCTGG + Intergenic
934820204 2:97366873-97366895 TTTAAAAGGCTGTTGGTGGCTGG - Intergenic
934953773 2:98599179-98599201 TTTTAGAGGCTGAGGGAGAAGGG + Intergenic
935436333 2:103038765-103038787 TTAAACAGGCTGATGGGTGAAGG - Intergenic
936728852 2:115357242-115357264 TTTTACAGGCACTAGGTGGAAGG - Intronic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
939629105 2:144513586-144513608 TTTCAGAGGCTGATGCTGGAAGG + Intronic
942166419 2:173245279-173245301 TTTTACAAGCAGATGGATGATGG + Intronic
945190743 2:207184972-207184994 TTCTACATGCTGACAGTGGAAGG - Intergenic
947903199 2:233739692-233739714 TTTTACAGGCTCATGGGGGAAGG + Intronic
947904614 2:233751349-233751371 TTTTACAGGCTCATGGGGGAAGG + Intronic
948318762 2:237052309-237052331 TTTGACAGGCTGAAGGAAGAAGG + Intergenic
948520279 2:238532167-238532189 TTTTACAGGCTCATAGGCGAAGG + Intergenic
1169377176 20:5075479-5075501 TTTGGGAGGCTGAGGGTGGATGG + Intronic
1169606251 20:7322892-7322914 TTGGACAGGTTGATGGTGAAGGG - Intergenic
1170503274 20:16996991-16997013 TTTCACATGCTGGTGCTGGAAGG - Intergenic
1171022286 20:21596605-21596627 TTTTACAAGTTGCTGGTGAATGG - Intergenic
1171085310 20:22233144-22233166 TTCTACATGCTGAAGGGGGATGG + Intergenic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1171132360 20:22665490-22665512 TTTTACAGGCTCATAGTTGGAGG - Intergenic
1173288379 20:41693040-41693062 CTTCACAGGCTGATGGGGAAGGG + Intergenic
1173821678 20:46023636-46023658 TTTTCCTGGCTGATGGAGGTGGG - Intronic
1173863978 20:46302617-46302639 TTTTACAGACTCATCCTGGATGG + Intronic
1177022934 21:15885594-15885616 TTTTAGGGGGTGGTGGTGGAAGG + Intergenic
1179473616 21:41629158-41629180 TTTTATAGGGTCATGCTGGAGGG + Intergenic
1179936723 21:44610705-44610727 TTTTCCAGGCACATGGTGCAAGG - Intronic
1181340196 22:22172725-22172747 TTTTACAGCCTTGAGGTGGATGG - Intergenic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
949140529 3:627722-627744 TTTCACAGGCTGATAGTTGGAGG - Intergenic
950797534 3:15522162-15522184 TGTCACAGGCTGACAGTGGAGGG - Intergenic
950990579 3:17433782-17433804 TTTTGCAGGCTCATAGAGGAAGG - Intronic
953390435 3:42530830-42530852 TTCTTCTGGCTGCTGGTGGAGGG + Exonic
953877371 3:46674001-46674023 TTTTGGAGACTGAGGGTGGAAGG + Intronic
955151889 3:56375561-56375583 GTTTATAGGCTGTTGATGGAAGG + Intronic
955471850 3:59294647-59294669 TTTCACAGGCTGGTGTTGAATGG + Intergenic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956327487 3:68069991-68070013 TTTTCCAGGCGCATGGTGCAAGG + Intronic
956491714 3:69779464-69779486 ATTTACAGGATAATGGAGGATGG + Intronic
956938493 3:74131324-74131346 TTTTACAGGCTCATAGTGGAAGG - Intergenic
958085962 3:88807518-88807540 TTTTTCAGGTTGAGGGTGGGTGG - Intergenic
958549961 3:95599635-95599657 TTTTACACGGAGAGGGTGGAGGG - Intergenic
959233559 3:103689982-103690004 TTTTACAGGCTCAAGGCAGAAGG - Intergenic
960843030 3:121979237-121979259 TTTTACAGGCTCATAGGTGAAGG + Intergenic
964598723 3:158470484-158470506 TGTTACAAGATGATGGTGGGGGG + Intronic
965028641 3:163335137-163335159 TTTTACAGGCTCAGAGGGGAAGG - Intergenic
965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG + Intronic
965857142 3:173102875-173102897 TTTTACAGGCTCATATTGGAAGG - Intronic
967292147 3:187931673-187931695 TTCTGGAGCCTGATGGTGGAGGG - Intergenic
967519769 3:190416149-190416171 TTTTACAGGCTTCTGAGGGAAGG - Intergenic
968176017 3:196550010-196550032 TTTTACAGGCTTATAGAGGAAGG + Intergenic
968947000 4:3670414-3670436 TCTCACAGGCTGATGGTGCCTGG - Intergenic
970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG + Intergenic
971221578 4:24712534-24712556 TTCTACTGGGTGATGGTGAAAGG + Intergenic
972807958 4:42549689-42549711 TTTTAGAGGCTGAGGCAGGAGGG + Intronic
974753852 4:66178089-66178111 TTTTATAGGCTGCTGCTAGAGGG + Intergenic
974883607 4:67788866-67788888 TTTGAAAGGCTGAAGTTGGAGGG - Intergenic
975086679 4:70349842-70349864 TTATACATGTTGATGGTTGATGG + Intergenic
975525967 4:75350948-75350970 TTATACAGGCTGATGTGGGTAGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
977950585 4:102966093-102966115 TTTTCCAGGCTGAGGTTGTATGG + Intronic
979327161 4:119393674-119393696 ATTTGCAGGTTGATGGAGGAAGG - Intergenic
980015462 4:127645431-127645453 AGTTACAGGCAGATGGTGGTTGG - Intronic
984174126 4:176395434-176395456 TTTTTCAGGCTGAAGGGAGATGG - Intergenic
986360806 5:6976063-6976085 TTTTACAGGCTCTTGGTGGAAGG + Intergenic
987541522 5:19261692-19261714 TTTTACAGGCTCTTGGTGGAAGG + Intergenic
987612424 5:20223405-20223427 TTTTAGGGGCTCATTGTGGAAGG + Intronic
988273858 5:29054997-29055019 TTGTACAGGGTGAAGATGGATGG - Intergenic
989406726 5:41069427-41069449 TTATACAGGCAGATGTTGAAAGG - Intronic
990022511 5:51145012-51145034 GATTACAGACTAATGGTGGAAGG - Intergenic
990125967 5:52518255-52518277 TTTTTCAGGCGCATGGTGCAAGG - Intergenic
990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG + Intronic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
992320056 5:75605060-75605082 CTTTACAGGCTGAGGTTAGAAGG - Intergenic
993831503 5:92765797-92765819 TTTTTCTAGCTGATGGTGTATGG + Intergenic
994560665 5:101366982-101367004 GTTTTCAGGCAGATGGGGGAGGG - Intergenic
994925717 5:106114898-106114920 CTTTACAGGCTCTTGGCGGAAGG + Intergenic
996191627 5:120550385-120550407 TTTTACAGGCACAGGGTGTAGGG + Intronic
996818432 5:127598740-127598762 TGCTAGAGGCTGATGGTGTATGG - Intergenic
997963460 5:138339017-138339039 TTTTGGGGGCTGCTGGTGGAGGG + Intronic
998148731 5:139745325-139745347 TGCCACAGGCAGATGGTGGAGGG + Intergenic
998927288 5:147140676-147140698 TTGAACAGGCTGAAGGTGGCTGG + Intergenic
999426503 5:151491933-151491955 TGTTACAGGCTGATGCTGTCGGG - Exonic
1000882490 5:166714267-166714289 TTTTACAGGCTCATAGCAGAAGG - Intergenic
1003484322 6:6562774-6562796 TTTTACAGGCTCATGTGGAAGGG - Intergenic
1003489495 6:6609091-6609113 TCTTACAGGTGGATGCTGGAGGG - Intronic
1003601674 6:7523408-7523430 TTTTAAAGGCTTATGGCAGAAGG + Intergenic
1003826335 6:9956357-9956379 GCTTATAGGCTGATGGTTGATGG + Intronic
1004455420 6:15787405-15787427 TTCTAGAGGCTGGGGGTGGAGGG + Intergenic
1005159994 6:22848261-22848283 TTTTACAGGGTCATGCTGTAGGG - Intergenic
1007244958 6:40454500-40454522 TTTTATAGGGTCATGCTGGAGGG + Intronic
1007791855 6:44313738-44313760 TTTTCCAGGCTGAGGGAAGAAGG + Intronic
1008099192 6:47372917-47372939 TTCTACAGGCTGTTGGTTCATGG - Intergenic
1008737425 6:54562758-54562780 TTTTATAGCCTTATGGGGGAGGG + Intergenic
1011378551 6:86718336-86718358 TTTTACAGGCTCATAGTGGAAGG - Intergenic
1013488351 6:110619489-110619511 TTTTACAGGGTCGTGTTGGAGGG + Intronic
1016071656 6:139746754-139746776 TTTTCCAGGCAGATGGTAGCGGG + Intergenic
1017293590 6:152769294-152769316 TTATTCAAGCTAATGGTGGACGG - Intergenic
1017306169 6:152921245-152921267 TTTTACAGGGTGTAGGTGGAGGG - Intergenic
1017593063 6:155997624-155997646 TTTTGCAGGCAGAAGATGGAAGG + Intergenic
1018407790 6:163505704-163505726 TTCTACAGGCTCATGGGAGAAGG + Intronic
1018519325 6:164628730-164628752 TCTTGCTGGCTGTTGGTGGAAGG - Intergenic
1019801692 7:3092577-3092599 TTTTGCAAGCTGATGGAGGTGGG - Intergenic
1022060968 7:26794669-26794691 TTTTACAATCTAATGGTGGTGGG - Intronic
1022703318 7:32781443-32781465 TTTTACAGGCTCATGGTGGAAGG - Intergenic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1023126316 7:36957889-36957911 TTTTACAGGGTGGTGCCGGAGGG - Intronic
1024083887 7:45877920-45877942 TTTTACAGGCCCAAGGTGAAAGG - Intergenic
1024373236 7:48610118-48610140 TTTTACAGGCTCATGCAGAAGGG - Intronic
1027137435 7:75635113-75635135 TTTTAGGGGTTGATGATGGAGGG - Intronic
1027748174 7:82105605-82105627 TCATACAGGCCGTTGGTGGAAGG - Intronic
1028261589 7:88673538-88673560 ATTTCCTGGTTGATGGTGGAGGG + Intergenic
1028807328 7:95043580-95043602 TTTTACAGGGTCATGCTAGAGGG - Intronic
1030967154 7:116006581-116006603 TTTTACAGGCTCATAGGCGAAGG + Intronic
1031232834 7:119131892-119131914 TTTAGCAGACTGATGGTGCAAGG + Intergenic
1031435523 7:121728116-121728138 TTTTACAGGCTCATAGGGGAAGG - Intergenic
1032248713 7:130234495-130234517 TTTTATAGGGTCATGATGGAAGG - Intergenic
1032709386 7:134448934-134448956 TTTTACTGTCTGATGCTGGTAGG - Intronic
1035460700 7:159036829-159036851 TTCTTCTGGCTGCTGGTGGAGGG - Exonic
1036610303 8:10344303-10344325 TTTGATTGCCTGATGGTGGAGGG - Intronic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1038705301 8:29887918-29887940 GTTTACAAGCTGATGGAGCAGGG - Intergenic
1043459774 8:80448163-80448185 TTTGACAGGCTGAGGTGGGAAGG + Intergenic
1043521637 8:81052462-81052484 TTTTGCAGACTGATGGTGGGTGG + Intronic
1044013412 8:87022248-87022270 TTTTACAGGGTCATGGTGCTAGG + Intronic
1044015277 8:87043128-87043150 TGTTACAGGGTCATGCTGGAGGG + Intronic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1044340774 8:91044219-91044241 TCTAAGAGGATGATGGTGGAAGG + Intergenic
1046600755 8:116314784-116314806 TTTTACAGGCTTCTAGTGGAAGG - Intergenic
1051294093 9:15576428-15576450 TTTGAGAGGCTGATGAGGGAGGG - Intronic
1053132512 9:35624673-35624695 TTTTACAGGTTGAAGGTTTATGG + Intronic
1053575059 9:39351113-39351135 TTTTACAGGTTGAAGGTTTATGG + Intergenic
1054096624 9:60909796-60909818 TTTTACAGGTTGAAGGTTTATGG + Intergenic
1054118027 9:61185422-61185444 TTTTACAGGTTGAAGGTTTATGG + Intergenic
1054589728 9:66997142-66997164 TTTTACAGGTTGAAGGTTTATGG - Intergenic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1056717124 9:89041117-89041139 TTTTATAGGCTGAAGAGGGAGGG - Intronic
1059535820 9:115079727-115079749 TTTTCCAAGGTGATGGTGAATGG + Intronic
1060810565 9:126609676-126609698 TTTTCCAGCCTGATGGGAGAGGG - Intergenic
1062291941 9:135799409-135799431 CTTTGCAGGCTGGTGGAGGAAGG - Intergenic
1062515730 9:136934374-136934396 TTTCACAGGCTCATAGTGGAGGG + Intronic
1187371256 X:18708628-18708650 TTATTCAGGCTTAAGGTGGAGGG + Intronic
1188128655 X:26402712-26402734 TTTTACAGTTTAATGGTGGGAGG + Intergenic
1188553233 X:31383648-31383670 TTTTACAGGCACAGGATGGAGGG - Intronic
1188865207 X:35305674-35305696 TTTTACAGGTGCATGGTGCAAGG - Intergenic
1188919388 X:35953584-35953606 TTTTACAGGCTAATGGCTGTTGG + Exonic
1189686847 X:43573401-43573423 ATTTACAGATTTATGGTGGATGG + Intergenic
1192119569 X:68442212-68442234 TTTTAGAGGCTGAGGTGGGAGGG - Intergenic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic
1194053641 X:89103820-89103842 TGTTACATGCTGATGATGGTGGG + Intergenic
1194560415 X:95412411-95412433 TTTTACAGGCTTATAGTGAAAGG + Intergenic
1195326730 X:103764496-103764518 TTTTAAAGGCTGCTGTGGGATGG + Intergenic
1196087645 X:111702747-111702769 TTTTAAAGTCTGGGGGTGGAAGG - Intronic
1196111079 X:111947861-111947883 TGTTCAATGCTGATGGTGGAGGG + Intronic
1197203320 X:123768049-123768071 CTTTAGAGGCTGATGTGGGAGGG - Intergenic
1197856499 X:130919035-130919057 TTTTACAGGCTCATGGCAGAAGG - Intergenic
1198028120 X:132728949-132728971 TGATACAGGCTGAAGGTGGAGGG - Intronic
1199540040 X:148948611-148948633 TTTTACAGGGTCATGCTGGAGGG + Intronic
1199566188 X:149217729-149217751 TTTTACAGGCTCAAGCTGGAAGG + Intergenic
1199768722 X:150959784-150959806 TTTCACACTCTGTTGGTGGAAGG + Intergenic
1200807278 Y:7445777-7445799 TTCAACATGATGATGGTGGAAGG - Intergenic