ID: 1022909123

View in Genome Browser
Species Human (GRCh38)
Location 7:34883053-34883075
Sequence CTCAGTAGGTACTCTGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022909118_1022909123 7 Left 1022909118 7:34883023-34883045 CCCTCTTCTCACAGCTCAACTAG 0: 21
1: 1783
2: 2123
3: 1311
4: 1138
Right 1022909123 7:34883053-34883075 CTCAGTAGGTACTCTGTGTAGGG No data
1022909119_1022909123 6 Left 1022909119 7:34883024-34883046 CCTCTTCTCACAGCTCAACTAGG No data
Right 1022909123 7:34883053-34883075 CTCAGTAGGTACTCTGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022909123 Original CRISPR CTCAGTAGGTACTCTGTGTA GGG Intergenic
No off target data available for this crispr