ID: 1022910151

View in Genome Browser
Species Human (GRCh38)
Location 7:34893010-34893032
Sequence TGTTCATTGCTGAAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022910148_1022910151 -3 Left 1022910148 7:34892990-34893012 CCGAAACAGGATTGTCTGGGTGT No data
Right 1022910151 7:34893010-34893032 TGTTCATTGCTGAAGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022910151 Original CRISPR TGTTCATTGCTGAAGCTGGG TGG Intergenic
No off target data available for this crispr