ID: 1022913281

View in Genome Browser
Species Human (GRCh38)
Location 7:34920811-34920833
Sequence CCCTTCTTAAGGAGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022913281_1022913287 8 Left 1022913281 7:34920811-34920833 CCATCCAGCCTCCTTAAGAAGGG No data
Right 1022913287 7:34920842-34920864 CACAAAGATGTTGAAAATCATGG No data
1022913281_1022913288 22 Left 1022913281 7:34920811-34920833 CCATCCAGCCTCCTTAAGAAGGG No data
Right 1022913288 7:34920856-34920878 AAATCATGGTGTCTATGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022913281 Original CRISPR CCCTTCTTAAGGAGGCTGGA TGG (reversed) Intergenic
No off target data available for this crispr