ID: 1022914865

View in Genome Browser
Species Human (GRCh38)
Location 7:34938011-34938033
Sequence ATTACATTCTAGAAGAGTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022914865_1022914866 19 Left 1022914865 7:34938011-34938033 CCATGACTCTTCTAGAATGTAAT 0: 1
1: 1
2: 1
3: 20
4: 289
Right 1022914866 7:34938053-34938075 CAGTTCTCGCTTCACTTCTTCGG 0: 1
1: 0
2: 1
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022914865 Original CRISPR ATTACATTCTAGAAGAGTCA TGG (reversed) Exonic
901787491 1:11634393-11634415 ATTTCATTCCAGAAGTGCCAGGG + Intergenic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
904579468 1:31530516-31530538 ATTTCCTTGCAGAAGAGTCATGG - Intergenic
906485992 1:46235519-46235541 ATTACTTTTTAGTAGAGCCAAGG - Intergenic
907537142 1:55173973-55173995 CCTACATTCTAGAAGAGATAGGG + Intronic
909851420 1:80469477-80469499 ATTACATTATAGCAGAGACAGGG - Intergenic
910496653 1:87836812-87836834 TTTACCTTTTAGAAAAGTCAAGG + Intergenic
911194614 1:94981163-94981185 CTTTCTTTCTAGAACAGTCAAGG + Exonic
913161444 1:116149608-116149630 TTTGCATTTTAGAAGATTCAAGG - Intergenic
914432276 1:147629627-147629649 CTTACATTTAAGAAAAGTCATGG + Intergenic
914725820 1:150326858-150326880 GTTACAATTTAGAAGAGGCAGGG + Intronic
916103644 1:161414173-161414195 ATTAGATTCTAGAAGATACAAGG + Intergenic
916251176 1:162739705-162739727 TTTACATTCTAAAAGATACATGG + Intronic
917578724 1:176351036-176351058 TTTACATTTTAGTAGAGACAGGG + Intergenic
917603953 1:176606390-176606412 AATACATTCTTGAAGAATGAGGG + Intronic
917644369 1:177015649-177015671 ATGAAATTCCAGAAGATTCATGG - Intronic
917882225 1:179348491-179348513 ATGACATTCTAGTAGGGTAAGGG + Intronic
918455446 1:184707372-184707394 TTTACATTTTAGTAGAGTGAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919282471 1:195508937-195508959 ATTACATGCAAGAACAGACATGG + Intergenic
920157653 1:203968046-203968068 ATTAGATTCTAGATAAGTCCTGG - Intergenic
921576802 1:216844665-216844687 ATTATTTTATAGCAGAGTCAGGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
923535684 1:234849750-234849772 ATTGCATTCTAGAAGAGACCTGG + Intergenic
923695159 1:236241603-236241625 ATTACAACTCAGAAGAGTCATGG + Intronic
923714227 1:236411365-236411387 ACTACAAGCTAGAAGAGACAAGG - Intronic
923997932 1:239517626-239517648 CAGACATTCTAGAAGAGTCATGG + Intronic
1066262182 10:33739628-33739650 CTTACCTTCTAGTAGAGGCATGG + Intergenic
1068057488 10:52028991-52029013 TTTACAATTTAGAAGAGTCATGG - Intronic
1068341305 10:55707238-55707260 ATGACATTTTAATAGAGTCATGG + Intergenic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1070212838 10:74344598-74344620 ATTACATTCCTGAAGTCTCATGG + Intronic
1071510651 10:86260577-86260599 ATGACATCCTAGAAGGCTCAAGG + Intronic
1073916369 10:108409160-108409182 AAAACATTGTAGAAGATTCATGG - Intergenic
1074340521 10:112624266-112624288 ATTTCATTCTAGACTAATCATGG - Intronic
1078311512 11:10248098-10248120 ATTACATTCTAGATAAGGCCTGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG + Intronic
1080184656 11:29467285-29467307 CTTACTTTATAGAAGAGTCATGG - Intergenic
1080215296 11:29832861-29832883 ATGAAATTTCAGAAGAGTCAAGG + Intergenic
1081460512 11:43268508-43268530 ATTTCATTCTATAACAGGCATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082892303 11:58153056-58153078 ATAACATTCTAGAAGATAGAGGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1084764799 11:71301369-71301391 ACCAGATTCTAGAAGAGACAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086242480 11:84712049-84712071 ATTACATGCCATAAGAGTCCAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088196852 11:107283738-107283760 ATGACATTTTTGAAGAGTAAGGG + Intergenic
1088879985 11:113965504-113965526 CTTACATTCTAGTGGAGGCAGGG + Intergenic
1089818627 11:121200522-121200544 TTTGTATTCTAGTAGAGTCAGGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091431870 12:442951-442973 ATTTTATTTTAGTAGAGTCAGGG + Intergenic
1092101232 12:5885207-5885229 ATAACTTTCTATATGAGTCAGGG - Intronic
1092102140 12:5893128-5893150 ATTATATTCTAGAAATGTTATGG - Intronic
1092653317 12:10657656-10657678 ATTAGATTCTAGATAAGTCCTGG + Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093616835 12:21235873-21235895 ATTACAAGCTAGAAGAGACTGGG - Intronic
1094334725 12:29336129-29336151 ATTACAGAGTTGAAGAGTCACGG + Intronic
1094431242 12:30372147-30372169 ATTACATTATAGATGAGGCCTGG - Intergenic
1095373321 12:41496129-41496151 ATCACATCCAAGAACAGTCATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097769706 12:63569241-63569263 ATTATGTTTTAGAAGAGGCATGG - Exonic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098321119 12:69244568-69244590 ATTTTATTTTAGAAGAGACAAGG + Intronic
1099046697 12:77729361-77729383 ATTTCATACTTGAAGAGTGAAGG + Intergenic
1099453748 12:82839399-82839421 AATACAACCTAGAAGAGTCTAGG - Intronic
1099977612 12:89562611-89562633 TTTACATTTTTGAAGAGACAGGG + Intergenic
1101004226 12:100385906-100385928 ACTAGAAGCTAGAAGAGTCAAGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1104168127 12:126253693-126253715 TTTAAATCCTAGAAGAGGCATGG + Intergenic
1104283074 12:127396251-127396273 ATTTCATTCTAGTAGAGGAATGG - Intergenic
1105625935 13:22112486-22112508 AATAATTTCTAGAAGAGACAAGG - Intergenic
1107171164 13:37343138-37343160 ATTACATTCTAGTGGAGGAAGGG - Intergenic
1108061663 13:46539128-46539150 ATGACATTCTAGAAAATGCATGG - Intergenic
1108338559 13:49472811-49472833 TTTACATTTAAGAAGAGTTAGGG - Intronic
1108853919 13:54770163-54770185 ATAACATTCTAGAATAATAAGGG + Intergenic
1110471329 13:75863379-75863401 AGTACATGGTAGAAGAGACAAGG + Intergenic
1111371881 13:87329875-87329897 ATTAGATTCTAAAATATTCATGG - Intergenic
1114299519 14:21361933-21361955 ATTATTTTTTAGAAGAGACAAGG + Intronic
1114361805 14:21982493-21982515 TTTACATTTTAGTAGAGACAGGG - Intergenic
1114451168 14:22826622-22826644 ATTAAATTTTAGTAGAGGCAAGG + Intronic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116700084 14:48230046-48230068 CTTACATGGTAGAAGAGGCAAGG - Intergenic
1117096522 14:52304094-52304116 CGTACATTCTACAAAAGTCAAGG + Intergenic
1119074194 14:71619696-71619718 ATTATTTTCTAGATGACTCAAGG - Intronic
1120196028 14:81483498-81483520 ATTACATTCTACAGAAGTCGTGG + Intronic
1120636515 14:86958570-86958592 ATTACATTCCAGTCGATTCAGGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122195488 14:100081949-100081971 TTTAAATTCTAGCAGAGACAGGG - Intronic
1122737557 14:103851858-103851880 AATACATTCTGGAAGAATCCAGG + Intergenic
1123837642 15:24212244-24212266 ATTACAGTCCAGAAGAGCTATGG + Intergenic
1128790312 15:70428432-70428454 CTTAGATGCTAGAAGAGCCAAGG + Intergenic
1132133552 15:99309063-99309085 ATTCCATTCTATAAGAATCTTGG + Intronic
1132278205 15:100588661-100588683 ATTAGATTCTAGATAAGTCTTGG + Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1138394922 16:56696555-56696577 AATACATTCCAGATGAGTGAAGG - Intronic
1140762788 16:78126235-78126257 ATAAAACTATAGAAGAGTCACGG - Intronic
1140881977 16:79206746-79206768 ATTTCATTATAGAAGTATCACGG + Intronic
1148228882 17:45918883-45918905 ATTTTATTTTAGAAGAGACAGGG - Intronic
1149714066 17:58770087-58770109 CTTGTATTCTAAAAGAGTCATGG + Intronic
1150037567 17:61820552-61820574 ATTACATTCTTTAAGTGGCAGGG - Intronic
1150119346 17:62586907-62586929 ATTTCCTTCTAGAAGAGACTGGG + Intronic
1154009851 18:10565113-10565135 CTGAAATTTTAGAAGAGTCATGG - Intergenic
1155137412 18:23009732-23009754 ATAATATTCTATATGAGTCATGG - Intronic
1155596547 18:27494516-27494538 GTTACATTCTAAAACAGTTACGG - Intergenic
1155775019 18:29750933-29750955 ATGACATTCAGGAAGAGTCAGGG - Intergenic
1156178824 18:34579456-34579478 AATACATACTATAAGAGACAAGG - Intronic
1157232673 18:45933504-45933526 TTTATATTCTAGTAGAGACAGGG - Intronic
1158448179 18:57539471-57539493 ATTATTTTCTAGAACAGTGATGG - Intergenic
1159155989 18:64583000-64583022 CTTACATACTATAAGTGTCAAGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1164188082 19:22889695-22889717 ATTTTATTTTAGAAGAGACAGGG - Intergenic
1167136603 19:47620008-47620030 GTGAAATTCTAGAAGAGGCAAGG - Intronic
1167674034 19:50873640-50873662 ATTGCAATGTGGAAGAGTCAGGG - Intronic
927468953 2:23357918-23357940 ATGATATTCTAGAAGTGACATGG + Intergenic
928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG + Intronic
930871595 2:56176548-56176570 ACTAGATACTGGAAGAGTCAAGG - Intergenic
931004576 2:57833581-57833603 ATTACATCACAGAACAGTCATGG + Intergenic
931044735 2:58339079-58339101 GTTACATTCCAGAAGCGACAAGG + Intergenic
932724990 2:74171728-74171750 TTTACATTTTAGTAGAGACAAGG - Intronic
932818680 2:74881574-74881596 ATTACATTCTAGAATACAGAAGG - Intronic
933555565 2:83826313-83826335 ATTAAATTCAAGAAAGGTCAGGG + Intergenic
938685481 2:133733702-133733724 ATTACAGTCTAGACGAGGCATGG - Intergenic
939394851 2:141615357-141615379 GTTACATTCTAGTAGAGAGAAGG - Intronic
940595918 2:155792879-155792901 TTTAAAATATAGAAGAGTCATGG + Intergenic
943226264 2:185182743-185182765 TCTACATTCTAGAAGAGGAAAGG + Intergenic
944713440 2:202356517-202356539 ATTGCATTGTTGAAGAGTCTTGG - Intergenic
945228129 2:207554397-207554419 AATATATTCTGGAAAAGTCATGG + Intronic
947301496 2:228692450-228692472 ATTACGATCTAGAAGAGTATTGG - Intergenic
1170098056 20:12668791-12668813 ATTCAAATCTAGAAGAGTTAAGG - Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1174757975 20:53178444-53178466 AGTACAATCAAGAGGAGTCAGGG - Intronic
1174845974 20:53943625-53943647 ATTACATTTTAATAGACTCAGGG + Exonic
1175075702 20:56370890-56370912 CTTACATTCTAGATTATTCAGGG - Intronic
1177755185 21:25337995-25338017 GGTACATTCTAGAAGAGACATGG - Intergenic
1178040854 21:28639547-28639569 AGGAAATTCCAGAAGAGTCAGGG + Intergenic
1178471765 21:32899905-32899927 ATAACATTCTTGAAGAGTGCCGG - Intergenic
1178489210 21:33037462-33037484 AATACATTCTACAAGTGGCAGGG - Intergenic
1180789385 22:18566353-18566375 TTTACATTCTGAAATAGTCAGGG + Intergenic
1181232356 22:21428958-21428980 TTTACATTCTTAAATAGTCAGGG - Intronic
1181246295 22:21505899-21505921 TTTACATTCTTAAATAGTCAGGG + Intergenic
1182314185 22:29432771-29432793 AATACATATAAGAAGAGTCATGG - Intergenic
1182991174 22:34769489-34769511 ATTACATTATAGAACAGCCAGGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183770158 22:39917645-39917667 ATTACATTTTAGAACAGTTAGGG - Intronic
949191612 3:1256159-1256181 ATTACATTCTATAATAGGCTTGG - Intronic
949688882 3:6611504-6611526 ATCAGATTCTTGAAGAGTCCTGG + Intergenic
949697415 3:6715154-6715176 ATGACATTTTAGAAGGGGCATGG + Intergenic
950059759 3:10060676-10060698 AATGCATTCTAAAAGAATCAGGG - Intronic
950319198 3:12034620-12034642 ATTACATTGCACAAGAGTGAGGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951496441 3:23332888-23332910 ATCACTTTTTAGAAGTGTCAAGG - Intronic
955002318 3:54938821-54938843 ATATGATTCTAGAAAAGTCAGGG + Intronic
955088857 3:55729659-55729681 ATTATTTTTTAGAAGAGACAAGG - Intronic
956698706 3:71940244-71940266 ATAACATTCTATAAGTTTCAAGG - Intergenic
958417170 3:93888500-93888522 ATTTCATTATAGAATAGTAAAGG + Intronic
959249025 3:103916545-103916567 ATTACAATCAAGAAGAGTTAGGG - Intergenic
960076163 3:113488001-113488023 ATTAGATTTTAGAAGATTCCAGG + Intronic
960386837 3:117030631-117030653 ATTAGATTCTAGATAAGGCATGG + Intronic
961026385 3:123561653-123561675 ATTAGATTGTGGAAGAGGCATGG - Intronic
963714819 3:148790997-148791019 ATCACATGCTAGGAAAGTCATGG - Intergenic
964451648 3:156818257-156818279 ACTACATTCTAGAAGAGTAAAGG - Intergenic
964902510 3:161676643-161676665 TTTATATACTAGAAAAGTCATGG + Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966282137 3:178244148-178244170 ATTTCATTCTAGAAATGGCAAGG + Intergenic
966389694 3:179438933-179438955 CTTACACACTTGAAGAGTCAAGG - Intronic
966507590 3:180724382-180724404 AATATATGCTAGAAGAGTGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967767540 3:193297578-193297600 ATAACATTCTATCAGAGTGACGG - Intronic
974568393 4:63609668-63609690 ATTCCATTATAGAAAAGTCCAGG + Intergenic
975393428 4:73847446-73847468 ACTGCATTCTAGGAAAGTCAGGG + Intronic
976111190 4:81675625-81675647 TTTTAATTCTAGAAGAGTTAGGG + Intronic
977363807 4:96040714-96040736 ATTCCAATCTAGAACAGTTAGGG + Intergenic
977592978 4:98847744-98847766 ATTAGATTCTAGATAAGGCATGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979359754 4:119747356-119747378 CTTACATTGTAGAAGAGGAAAGG + Intergenic
980460279 4:133101942-133101964 ATTACATACTAGAAGAATATGGG + Intergenic
981159211 4:141476830-141476852 ATTATATTTTAGTAGAGACAGGG + Intergenic
982256363 4:153455200-153455222 CTCACATTGTAGAAGAGGCAAGG - Intergenic
982567158 4:156999477-156999499 ATTATTTCCTAGAAGAGTCTAGG - Intergenic
982764189 4:159324592-159324614 AATTGATTTTAGAAGAGTCATGG + Intronic
984303877 4:177961979-177962001 ATTATATTCTAGATGCTTCATGG + Intronic
987166044 5:15199562-15199584 ATTAGATTCTAGATGAGGCCTGG - Intergenic
987683954 5:21172241-21172263 CTTACATTCTAGAGGTGACAAGG - Intergenic
988475352 5:31580099-31580121 ATGACATTCCAGAAAAGGCAGGG + Intergenic
989321233 5:40136495-40136517 AATAAAATCCAGAAGAGTCAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991266249 5:64721792-64721814 ATAACATTCTATAATAGTAAAGG - Exonic
991602212 5:68364665-68364687 GTTACCTTCTAGAAGCTTCAGGG - Intergenic
992848676 5:80781278-80781300 CTCACATTCTAGAAGGGTCCTGG + Intronic
992902811 5:81315944-81315966 ATTATATTCTAGCAGAGAGATGG - Intergenic
993637367 5:90361172-90361194 AATACATTCTGGAACTGTCAAGG - Intergenic
994850210 5:105045346-105045368 ATTACAGTCAAGGAGACTCAAGG + Intergenic
995016932 5:107320458-107320480 ATTACCTTTTAGCACAGTCACGG - Intergenic
996159287 5:120143256-120143278 ATTCCATTCTAAAAAAGGCAGGG + Intergenic
996762664 5:127001933-127001955 ATTACTTTATAGGAGACTCAAGG + Intronic
996858006 5:128031504-128031526 ATTTTATTCTAGAAGTTTCATGG - Intergenic
999085140 5:148881579-148881601 CTTCCATTCTAGAAAAGTCCTGG + Intergenic
1000480352 5:161766333-161766355 ACTACATTGTGGAAGAGTCCAGG - Intergenic
1000656176 5:163880925-163880947 GGTACATTTTAGAAGAGTAAAGG + Intergenic
1000818275 5:165951407-165951429 ATTTCATTTTAGATGTGTCATGG - Intergenic
1001538608 5:172520400-172520422 ATGACATTCTGGAAAAGACAAGG + Intergenic
1001623557 5:173109975-173109997 ATAACATTATAGAAGACTCAAGG - Intronic
1002964351 6:1947781-1947803 ATTAAATGCTAGAAGAATAATGG - Intronic
1003483619 6:6555656-6555678 ATTCCATGCTAGAAGAAGCAGGG - Intergenic
1004561452 6:16755813-16755835 ATTACTTTCCAGAAAATTCATGG - Intronic
1006490869 6:34386626-34386648 ATTACCTTCTAATATAGTCATGG + Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008043299 6:46825575-46825597 AGTACATTAAAGAAGAGTAAAGG - Intronic
1009724931 6:67526365-67526387 ATCACATTCTAGAGAAGCCATGG + Intergenic
1009744305 6:67793772-67793794 AATACTTTTCAGAAGAGTCAAGG - Intergenic
1010390458 6:75331381-75331403 GTTATATTCTATATGAGTCAGGG - Intronic
1010532550 6:76986602-76986624 GTTGCATTCTAAAAAAGTCACGG - Intergenic
1011051298 6:83153169-83153191 ACTACATTTTAGCTGAGTCAGGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011694522 6:89900010-89900032 ATGACATTCTGGAAAAGGCAAGG - Intergenic
1012842732 6:104350437-104350459 ATTACATTTTAGAATAACCATGG - Intergenic
1013044976 6:106476381-106476403 ATTAAATTCTATAAACGTCAAGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014926790 6:127281609-127281631 AACACATTTTAGAGGAGTCAGGG + Intronic
1015579008 6:134703182-134703204 ATTTCATTCTAAAAGACTAATGG + Intergenic
1016050295 6:139523596-139523618 CTTTCATTGTAGAAGAGACAAGG + Intergenic
1016329289 6:142939714-142939736 TTTACAATCTAGAAGAGACATGG - Intronic
1016957305 6:149639125-149639147 TTTACATTTTAGTAGAGACAGGG - Intronic
1017024911 6:150173219-150173241 AAGACATGCTAGAAGAGACAGGG - Intronic
1017368471 6:153674197-153674219 ATTAAAGTCTAGAATAATCATGG - Intergenic
1018074780 6:160202012-160202034 ATTATATTCTAGACTAGCCAGGG + Intronic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG + Intronic
1021813585 7:24426471-24426493 ATTACATTCTGGAACAGTGAGGG - Intergenic
1022267113 7:28767852-28767874 ATTAAATTCTAGATGGATCATGG - Intronic
1022367201 7:29733539-29733561 ATTATGTTTTAGAAGAGGCATGG + Intergenic
1022708306 7:32827478-32827500 ATTACATTCTAGAAAAGTCATGG + Intergenic
1022761387 7:33356829-33356851 ATTTCTTTATAGAGGAGTCAGGG - Intronic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1022928979 7:35090337-35090359 ATTATGTTTTAGAAGAGGCATGG - Intergenic
1022950708 7:35335407-35335429 CTTTCATTCTAGAAAAGCCAGGG + Intergenic
1024439510 7:49399721-49399743 TTTACCTTCTAGAAGAGACAAGG - Intergenic
1025120148 7:56294963-56294985 ATTGAATTCTAGAACTGTCAAGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028321697 7:89467184-89467206 ATTTCATTTTAGAAAAATCATGG - Intergenic
1028357106 7:89923880-89923902 ATCACATTTTGGAAGAGTAAAGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029811032 7:103049214-103049236 ATTACATTCTAAATAAGTCCTGG - Intronic
1029825089 7:103184019-103184041 ATTATGTTTTAGAAGAGGCATGG - Intergenic
1031454397 7:121961538-121961560 ATTACATTCCAGAAGGGTGGGGG - Intronic
1031518986 7:122739469-122739491 ATTACAGTGTAGAAAATTCATGG + Intronic
1031519931 7:122751497-122751519 TTTACATTCTGCAAGATTCAGGG - Intronic
1031594872 7:123638344-123638366 ATAAAATTCTAGAAGGTTCAAGG - Exonic
1033071423 7:138206770-138206792 ATTATATTTTAGTAGAGACAGGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033579013 7:142714751-142714773 ACTACATTTTAAAAGAGTCTAGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035598461 8:880309-880331 TCTACATTCTAGAAGACGCATGG - Intergenic
1039192170 8:34988630-34988652 CTTACATGGTAGAAGAGACAAGG + Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040754131 8:50750065-50750087 ATTACATTATATATGATTCATGG + Intronic
1041913754 8:63118587-63118609 ATCACAGTCTAAAAGAGCCAAGG - Intergenic
1042843138 8:73144836-73144858 ATGAAATTCTAGAACAGGCAAGG - Intergenic
1042940711 8:74104929-74104951 AATACATTCCAGAATAGTAAAGG - Intergenic
1044957593 8:97497812-97497834 ATTACATACTATATGACTCAAGG + Intergenic
1046063518 8:109168588-109168610 ATTAGATTCCAGATGAGTCATGG - Intergenic
1046142420 8:110111361-110111383 ATTACCTTCAAGAAGAGAAAGGG - Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1048641953 8:136373354-136373376 TTTACCTTTTAGAAGAGTCTAGG - Intergenic
1048648147 8:136444983-136445005 AGAAAATTCTGGAAGAGTCAGGG - Intergenic
1050289674 9:4140636-4140658 ATTACAGTCTAGAGGAGGAAAGG - Intronic
1050416072 9:5418940-5418962 CTGACATTCTAGCAGAGTCCTGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051710299 9:19924450-19924472 ATGACATTCTAGAAGCCACAAGG - Intergenic
1055003775 9:71483008-71483030 TTTACTTTTTAGAAGAGACAAGG + Intergenic
1055089660 9:72349976-72349998 ATTACATTAGTGAAGATTCAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056727535 9:89133943-89133965 ATTAGATTCTAGATGAGGCCTGG + Intronic
1058151393 9:101467370-101467392 ATTCCTTTCTTGAAGAGTAAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1059828125 9:118056849-118056871 ATTCCATTATAGAAAGGTCATGG + Intergenic
1060465373 9:123899557-123899579 ATTACATTCCAGAATAGACAGGG - Intronic
1062728156 9:138090440-138090462 ATTTTATTCTAGTAGATTCATGG - Intronic
1186515172 X:10161408-10161430 ATTACCTTGTTGAAGAGACAAGG - Intronic
1186748044 X:12590736-12590758 ATTCCATTCTAAAAGTGCCAAGG + Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187037154 X:15552506-15552528 ATTACAATCCAGAAGAAACATGG - Intronic
1187157124 X:16730877-16730899 ATTAGATTCTAGAAAAGGCCTGG - Intronic
1187399179 X:18944460-18944482 ATTACATTCTGGAGGAGGGAGGG + Intronic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189040688 X:37539571-37539593 AATACACTCAAGAAGAGACATGG + Intronic
1190144902 X:47881600-47881622 AATACTTTCCAGAAGAGACAAGG - Intronic
1190192559 X:48289861-48289883 AATTCATTCTAGAACAGGCATGG + Intergenic
1190395768 X:49981165-49981187 AATTCATTCCAGATGAGTCAAGG - Intronic
1190558548 X:51663945-51663967 AGTACATTGTAGGGGAGTCAAGG - Intergenic
1191633653 X:63352506-63352528 ATTAAAATCCAGAAGAGTCTAGG + Intergenic
1192367477 X:70486170-70486192 ATTACATTCTTTAAGAGCAAGGG - Intronic
1192539546 X:71956607-71956629 GTTACATTCTGGCAGGGTCATGG + Intergenic
1193133199 X:77940485-77940507 AATAAATTCTAGATGAGTTAAGG + Intronic
1193383182 X:80840901-80840923 GTTAAATTCTAGAAGATTCATGG - Intergenic
1193962519 X:87943319-87943341 ATTACATTCTAGGAGAATAAAGG - Intergenic
1195663023 X:107400070-107400092 CTTCCATTCTAGAAAAGCCAGGG - Intergenic
1195857500 X:109347066-109347088 ATAATATTGTAGGAGAGTCAGGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197729307 X:129796233-129796255 ATTAAATTCTAGAAGGGAAATGG - Intergenic
1198256780 X:134931058-134931080 CTTACATTCTAGAGGAGGGAGGG - Intergenic
1198540167 X:137629598-137629620 ATTAAATTCTAAAAGAGAAATGG - Intergenic
1201797189 Y:17909347-17909369 ATTAAATTCTAAAAGAGGAATGG + Intergenic
1201804364 Y:17996638-17996660 ATTAAATTCTAAAAGAGGAATGG - Intergenic
1202358562 Y:24078389-24078411 ATTAAATTCTAAAAGAGGAATGG + Intergenic
1202512216 Y:25591724-25591746 ATTAAATTCTAAAAGAGGAATGG - Intergenic