ID: 1022916375

View in Genome Browser
Species Human (GRCh38)
Location 7:34958612-34958634
Sequence GAAGTGAAATTGATGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022916372_1022916375 29 Left 1022916372 7:34958560-34958582 CCTTATGTGTATACCTTATGTGC 0: 1
1: 1
2: 0
3: 21
4: 142
Right 1022916375 7:34958612-34958634 GAAGTGAAATTGATGGATCAAGG No data
1022916373_1022916375 16 Left 1022916373 7:34958573-34958595 CCTTATGTGCATGTCAGTACATT 0: 1
1: 1
2: 4
3: 16
4: 165
Right 1022916375 7:34958612-34958634 GAAGTGAAATTGATGGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022916375 Original CRISPR GAAGTGAAATTGATGGATCA AGG Intronic
No off target data available for this crispr