ID: 1022916375 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:34958612-34958634 |
| Sequence | GAAGTGAAATTGATGGATCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022916372_1022916375 | 29 | Left | 1022916372 | 7:34958560-34958582 | CCTTATGTGTATACCTTATGTGC | 0: 1 1: 1 2: 0 3: 21 4: 142 |
||
| Right | 1022916375 | 7:34958612-34958634 | GAAGTGAAATTGATGGATCAAGG | No data | ||||
| 1022916373_1022916375 | 16 | Left | 1022916373 | 7:34958573-34958595 | CCTTATGTGCATGTCAGTACATT | 0: 1 1: 1 2: 4 3: 16 4: 165 |
||
| Right | 1022916375 | 7:34958612-34958634 | GAAGTGAAATTGATGGATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022916375 | Original CRISPR | GAAGTGAAATTGATGGATCA AGG | Intronic | ||
| No off target data available for this crispr | |||||