ID: 1022919684

View in Genome Browser
Species Human (GRCh38)
Location 7:34999976-34999998
Sequence TGGGGAAGACAGATGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022919676_1022919684 0 Left 1022919676 7:34999953-34999975 CCTAGACAAAGGGATACACAGGG 0: 1
1: 0
2: 2
3: 20
4: 183
Right 1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG No data
1022919671_1022919684 23 Left 1022919671 7:34999930-34999952 CCAAAGATCTGAAAGTGGCTTTC 0: 1
1: 0
2: 4
3: 13
4: 330
Right 1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG No data
1022919674_1022919684 1 Left 1022919674 7:34999952-34999974 CCCTAGACAAAGGGATACACAGG 0: 1
1: 0
2: 1
3: 11
4: 208
Right 1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022919684 Original CRISPR TGGGGAAGACAGATGGGGCA AGG Intronic
No off target data available for this crispr