ID: 1022920330

View in Genome Browser
Species Human (GRCh38)
Location 7:35006510-35006532
Sequence CACACTGGGTCTTAAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022920326_1022920330 6 Left 1022920326 7:35006481-35006503 CCTTCTTACTTGCAGAACAGAGA 0: 2
1: 0
2: 0
3: 21
4: 186
Right 1022920330 7:35006510-35006532 CACACTGGGTCTTAAGAAACTGG 0: 1
1: 1
2: 1
3: 13
4: 174
1022920325_1022920330 14 Left 1022920325 7:35006473-35006495 CCAATGCTCCTTCTTACTTGCAG 0: 2
1: 0
2: 2
3: 12
4: 179
Right 1022920330 7:35006510-35006532 CACACTGGGTCTTAAGAAACTGG 0: 1
1: 1
2: 1
3: 13
4: 174
1022920324_1022920330 21 Left 1022920324 7:35006466-35006488 CCAACAACCAATGCTCCTTCTTA 0: 2
1: 0
2: 0
3: 10
4: 162
Right 1022920330 7:35006510-35006532 CACACTGGGTCTTAAGAAACTGG 0: 1
1: 1
2: 1
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022920330 Original CRISPR CACACTGGGTCTTAAGAAAC TGG Intronic
905394235 1:37657060-37657082 CACACTGGGTGGGAGGAAACCGG + Intergenic
908779549 1:67677215-67677237 GGCACTGTGTCTTAATAAACAGG - Intergenic
915003818 1:152618416-152618438 CACATTATTTCTTAAGAAACTGG + Intergenic
920840114 1:209546959-209546981 AGCCCTGGGCCTTAAGAAACTGG - Intergenic
921047385 1:211487163-211487185 CATTCTCGGTCTTAAGAAAGGGG - Intronic
921577744 1:216856796-216856818 TTAACTGGGTCTTAAGAGACTGG - Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
923240879 1:232084396-232084418 CACACTGTGTCTTTGAAAACCGG + Intergenic
1065977451 10:30854967-30854989 CACACTTGGTCATAAAAAATAGG - Intronic
1068022579 10:51603636-51603658 CTCACTGGTTCTTAGGATACTGG + Intronic
1069130315 10:64692788-64692810 CTCACTGCGTCTAAAGCAACTGG + Intergenic
1069531787 10:69225151-69225173 CCAACTGGGTCTCAAAAAACAGG + Intronic
1071613183 10:87050013-87050035 CACACTGGCAGTTAAGTAACTGG + Intergenic
1076389600 10:130088934-130088956 CACACTGGGGCTTTACCAACAGG + Intergenic
1076523065 10:131093200-131093222 CATACTTATTCTTAAGAAACGGG - Exonic
1076591355 10:131585983-131586005 CACACTGGGGCTTCAGGCACAGG + Intergenic
1080775332 11:35380865-35380887 CACCCTGGGCTTAAAGAAACAGG + Intronic
1081340423 11:41920741-41920763 CACACTGAGTCTCCAGTAACTGG + Intergenic
1081425910 11:42926290-42926312 CACAGTGGGTCTCTAGAACCTGG + Intergenic
1081601459 11:44497872-44497894 CTCACTGAACCTTAAGAAACAGG + Intergenic
1081620363 11:44615670-44615692 CACTCTGGGTTTTAGGAAACTGG + Intronic
1081683263 11:45023548-45023570 GACACTGGGACCTAAGAAAATGG + Intergenic
1081703832 11:45168733-45168755 CACACTGGGTCTCCAGCACCCGG + Intronic
1083529462 11:63406215-63406237 CAGACTGTGTCTTATGAAGCAGG - Intronic
1084514627 11:69629834-69629856 CACGCTGGGTCTTAGGGCACAGG - Intergenic
1086199918 11:84189805-84189827 CACACTGGGTCTTATCAGAGAGG + Intronic
1086656180 11:89358840-89358862 CAAACTGTTTCTTAAGAAAATGG + Intronic
1086892164 11:92270880-92270902 CACTTTGGGTCCTAAGAAATTGG - Intergenic
1089079963 11:115767454-115767476 CACACTGGGCCTTCAGAAATGGG + Intergenic
1089562014 11:119348030-119348052 CACACTGTGTGTTAAGAGCCTGG + Intergenic
1090183973 11:124724168-124724190 CACAATGGGTCCTCAGAAGCTGG - Intergenic
1090212115 11:124928437-124928459 CACACTGGGTCCCGAGAAAGGGG - Intronic
1090353249 11:126121341-126121363 CAGACTGGGTGTTAAGAATGAGG + Intergenic
1094442038 12:30488971-30488993 CACACTGGGTCTTCAAAAGTGGG + Intergenic
1100860515 12:98800637-98800659 AACACTGGGTCTCAAAACACTGG - Intronic
1103541417 12:121669093-121669115 GACAGAGGGTCTTGAGAAACTGG - Intronic
1104330321 12:127838579-127838601 AACAAAGGGTCTTAAGACACTGG + Intergenic
1106120051 13:26852534-26852556 CACACTGGTTCATATGAAACAGG - Intergenic
1107422592 13:40262537-40262559 CACACTGAGTTTTAAAAAAATGG - Intergenic
1108777650 13:53785589-53785611 CATACTGGGTCTTGAGCAACAGG + Intergenic
1112557291 13:100480405-100480427 CACACAAGGTCTTAAGACACAGG - Intronic
1117613344 14:57506537-57506559 CACAATGGGTATTCAAAAACAGG - Intergenic
1118715260 14:68555356-68555378 CACACTGGCTCTTAAGGAAGTGG + Intronic
1119936417 14:78596190-78596212 CACACTGGATCTCTAGATACAGG + Intronic
1120982210 14:90300135-90300157 CACAGAGGGTCTTAGGAAAGGGG + Intronic
1121398197 14:93646704-93646726 CACACTGGTGTTTTAGAAACAGG - Intronic
1125265589 15:37876632-37876654 CACCTTGGGTCTTCAGAAATCGG + Intergenic
1127668706 15:61173936-61173958 CACACTGGGTCTGAATCAGCAGG + Intronic
1131521991 15:93123381-93123403 CACACTGAGTATCAAGAAGCTGG + Intergenic
1131925573 15:97379695-97379717 CAGACTGGGTCTTTTTAAACTGG + Intergenic
1138964809 16:62071378-62071400 CACACTGGGCCTTAAGCAAAAGG - Intergenic
1145088400 17:19964412-19964434 CACACTGGGTGTTGATAAATGGG - Intronic
1145294388 17:21576225-21576247 CACCCTAGCTCTTAGGAAACTGG + Intergenic
1145369444 17:22296955-22296977 CACCCTAGCTCTTAGGAAACTGG - Intergenic
1146482710 17:33217911-33217933 CCCTCTGGGTCTTGAGAAAAGGG + Intronic
1146691207 17:34877442-34877464 AACACTGGGCCTCAAGAAAAAGG + Intergenic
1146821354 17:35985648-35985670 CTGACTGGGTCTCAGGAAACAGG - Intronic
1151429940 17:74055632-74055654 CAGACTGGGGCTTAAACAACAGG - Intergenic
1152934453 17:83127901-83127923 AACACAGGGCCTTAAGAACCTGG - Intergenic
1153336050 18:3925905-3925927 CACACTGAGTTTTAGGAAATAGG + Intronic
1153336057 18:3925976-3925998 CACACTGAGTTTTAGGAAATAGG + Intronic
1157209054 18:45725716-45725738 CAGACTGGGTCTTATGGAATAGG - Intronic
1158187895 18:54792158-54792180 CCCACTGGGTCTTCAGGAGCTGG + Intronic
1160556949 18:79731491-79731513 CCTACTGGGTCTCAAGGAACTGG - Intronic
1161120351 19:2522244-2522266 CTCACTGGGTCCTACGAAGCAGG - Intronic
1161577126 19:5060494-5060516 CACAGAGGGTCTGAAGAGACAGG - Intronic
1161960247 19:7519354-7519376 GGCTCTGGGTCTTCAGAAACCGG - Exonic
1165772787 19:38388530-38388552 CCCTCTGGATCTTAAGAAAATGG + Intronic
1168238490 19:55078161-55078183 AGAACTGGGTCTAAAGAAACAGG + Intronic
925166902 2:1721350-1721372 CACACTGGGTCTTTCTGAACAGG - Intronic
926976533 2:18521570-18521592 CACCCTGGGTCTTCAGAGATTGG - Intergenic
927363935 2:22272342-22272364 CACCCTGAATCTTAGGAAACAGG + Intergenic
927364271 2:22275814-22275836 CACCCTGAATCTTAGGAAACAGG + Intergenic
927364300 2:22276189-22276211 CACCCTGAATCTTAGGAAACAGG + Intergenic
929452199 2:42045629-42045651 CACACAGGGGCCTGAGAAACAGG - Intergenic
930102847 2:47616475-47616497 CACACTGTGCCTTAAGACATCGG + Intergenic
932095007 2:68839611-68839633 CACACTGGGGCTCAAGAGGCAGG - Intergenic
934306866 2:91832451-91832473 CACACTGAGGCTCAAGAAAAGGG + Intergenic
934326390 2:92020291-92020313 CACACTGAGGCTCAAGAAAAGGG - Intergenic
934464750 2:94250907-94250929 CACACTGAGGCTCAAGAAAAGGG - Intergenic
936147335 2:109988743-109988765 AACACTGGGTCTTATGTGACTGG + Intergenic
936197357 2:110382741-110382763 AACACTGGGTCTTATGTGACTGG - Intergenic
938868568 2:135450657-135450679 AACAATGGGTTTTAAGACACTGG + Intronic
939063349 2:137451002-137451024 CAAACTGGATCTCAAGAATCAGG + Exonic
939911090 2:147984149-147984171 CACACTGGGTGTAACTAAACAGG - Intronic
941135182 2:161707269-161707291 CACAATGAGTCTTAAGAAACTGG - Intronic
944373270 2:199011345-199011367 CACCCTGGGTCTTCTGAAACAGG + Intergenic
947259999 2:228210276-228210298 AACACAGGTTCTTAAGAAAGAGG - Intergenic
1171860343 20:30395684-30395706 CACATTGCTTCTCAAGAAACAGG + Intronic
1176595790 21:8694079-8694101 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1177103067 21:16918866-16918888 GAGACTGGGTCTTAATAAAAAGG - Intergenic
1178342624 21:31799174-31799196 CACACTGGGTTTTAAATACCTGG - Intergenic
1179469539 21:41601422-41601444 CAGACTGGGTCTTCACACACAGG - Intergenic
1180278650 22:10671192-10671214 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1180585902 22:16890054-16890076 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1183387129 22:37521224-37521246 CACACTGGGTCTGAACAGGCAGG + Intergenic
1183689291 22:39379228-39379250 CAGACTAGGTCTAAAGAAATTGG - Intronic
949970960 3:9403728-9403750 CATACTAAGTCTTAATAAACTGG - Intronic
952092090 3:29899611-29899633 CACACTAGGTCATAAGAAAGTGG - Intronic
953746787 3:45580633-45580655 CTCACTGGATCTCAAGAAAGAGG + Intronic
953828796 3:46277709-46277731 CAGACTGGGTCTTAAAAGACAGG + Intergenic
955389871 3:58513968-58513990 CCCACTGGTTCCTAAAAAACTGG - Intronic
960396569 3:117144711-117144733 CACACTGGGTTTGAAGAACCTGG + Intergenic
961010156 3:123430186-123430208 CAGTCTGGGACTTAAGGAACAGG - Intronic
963066096 3:141265837-141265859 CTCCCTGGGTCTGAAGAAAGAGG + Intronic
966742256 3:183244685-183244707 AACACTGGGTTTCAAGAAACTGG - Intronic
966742279 3:183244947-183244969 AACACAGGGTTTCAAGAAACTGG + Intronic
967188548 3:186965795-186965817 TACACTGGGACTTCAGATACAGG - Intronic
970395106 4:15656993-15657015 CACAGTCTGTCTTAAGAAGCAGG + Intronic
972217045 4:36909202-36909224 CAGACTGGGTATTAGTAAACTGG + Intergenic
973152432 4:46905384-46905406 CACACTGTGTTCTTAGAAACCGG + Intronic
973895308 4:55406445-55406467 CACACCACGTCTCAAGAAACAGG - Intronic
974157354 4:58091639-58091661 CACAATGTGACTTTAGAAACAGG + Intergenic
975684185 4:76903540-76903562 TACCCTGGGTGTTTAGAAACAGG + Intergenic
976041758 4:80894466-80894488 CACACTGGGACTTCAGCAATTGG - Intronic
976951193 4:90833592-90833614 TACACTGGTTCTTAGGAGACTGG - Intronic
978787742 4:112628842-112628864 GACACTGGATCTAAAGAAAAAGG + Intronic
980382702 4:132045214-132045236 CAGACTGGGACTTAAACAACTGG - Intergenic
981236199 4:142418741-142418763 CAAAATGGGTCTTAAGGAGCAGG - Intronic
983299775 4:165910162-165910184 CACACTAAGCCTTAAGAAACTGG - Intronic
986590154 5:9360298-9360320 CAGTCAGGGTCTTAAGAAATTGG + Intronic
987250094 5:16090998-16091020 CACACTGGCTATTAAGAACAGGG + Exonic
987816588 5:22908907-22908929 AACACTGTGTGTTAAGAGACAGG + Intergenic
988691354 5:33576060-33576082 CACACTGGATCGTCGGAAACTGG - Exonic
989582949 5:43050571-43050593 CACACTCAGACTTGAGAAACTGG + Intergenic
990126252 5:52521670-52521692 CTCACTTGTTCTCAAGAAACCGG - Intergenic
990720053 5:58684576-58684598 CACACTGGTTCATAGGAAAAAGG + Intronic
991917231 5:71617066-71617088 CACACGGGGGCTTAAGTATCGGG - Intronic
994278865 5:97875847-97875869 CACACTGGCTCTTATGGAAATGG - Intergenic
996328102 5:122298901-122298923 TACACTGGGTCTGATGAAATTGG - Intergenic
998105859 5:139468813-139468835 CACACTTTGTCTTATGTAACAGG - Intergenic
998222958 5:140302876-140302898 CTCACTGGGTCTCCATAAACGGG - Intronic
998967034 5:147552196-147552218 CAGACTGGGTCTTGAAAAATGGG + Intergenic
999709412 5:154303143-154303165 AACACTGGTTTTTAAGACACTGG + Intronic
1000840928 5:166217302-166217324 CACACTGGCTCTTCAGCCACTGG - Intergenic
1003389724 6:5703333-5703355 TGTACTGGGTCTTAAGCAACAGG - Intronic
1004051965 6:12091828-12091850 CACAATGTGTGTTAAGAATCAGG - Intronic
1004402387 6:15300654-15300676 GACACTGGGTCTTTGCAAACAGG - Intronic
1008321499 6:50119774-50119796 CACAAAGGGTCTAAAAAAACTGG + Intergenic
1008410753 6:51175835-51175857 CAAACTGGGTTGAAAGAAACAGG + Intergenic
1009885820 6:69622723-69622745 CACAATGGGCCTCAAGACACGGG - Intergenic
1010236674 6:73580446-73580468 CACACTGGGGCCTCAGAACCCGG - Intergenic
1011771371 6:90677006-90677028 CTCTCTGGGTGTTAAAAAACTGG + Intergenic
1014163336 6:118195622-118195644 CTGACTGGGTCAGAAGAAACTGG - Intronic
1016369477 6:143357247-143357269 AAGAGTGGGGCTTAAGAAACTGG + Intergenic
1022243525 7:28535121-28535143 CACACTGGGCCTTAAAGAGCCGG - Intronic
1022692658 7:32671984-32672006 CACATTGGGTCTTAAGAAACTGG + Intergenic
1022920330 7:35006510-35006532 CACACTGGGTCTTAAGAAACTGG + Intronic
1024822837 7:53353358-53353380 AACAATGGGTTTTAAGACACTGG + Intergenic
1025587750 7:62813781-62813803 AACACTGTTTCTTTAGAAACTGG - Intergenic
1025752933 7:64308806-64308828 CACATTGTGATTTAAGAAACTGG - Intronic
1028636263 7:92993017-92993039 CCCAGTGGATCTCAAGAAACTGG - Intergenic
1029105664 7:98173337-98173359 TGCTTTGGGTCTTAAGAAACTGG - Intronic
1029897298 7:103996950-103996972 CACAGTGGGTCAGTAGAAACAGG + Intergenic
1032439846 7:131934213-131934235 CAAACTGGATCTGAAGAACCCGG + Intergenic
1032627007 7:133602224-133602246 CACACTGGCTTTTATGAAATTGG + Intronic
1032632999 7:133673990-133674012 CACAGTAGGTCTTAAGAATAGGG - Intronic
1032859357 7:135862813-135862835 GACACTGGGTCTTGAGTGACTGG - Intergenic
1034262773 7:149766953-149766975 AACACTGGCTCTGGAGAAACAGG + Intronic
1037463718 8:19138680-19138702 CACGGTGCGTCTTCAGAAACAGG + Intergenic
1037584878 8:20269433-20269455 CACTCTGGGTGTTAAAAATCTGG - Intronic
1039433250 8:37542267-37542289 CACACTGGGGCATAAGGATCGGG + Intergenic
1041030142 8:53728363-53728385 CACACTGAGTCTGAAAAATCTGG - Intronic
1041992375 8:64008858-64008880 CTCACTGTGTTTTAAGCAACTGG + Intergenic
1043002962 8:74782007-74782029 GACACTGGGTCTTGAGCAATCGG + Intronic
1043963814 8:86448763-86448785 AACACTGAGTTTCAAGAAACAGG - Intronic
1048602468 8:135932640-135932662 GACTCTGGGAATTAAGAAACTGG + Intergenic
1049993238 9:1009855-1009877 CACACTGAGTCTGAGGACACGGG + Intergenic
1050486711 9:6142072-6142094 GGCACTGGGCTTTAAGAAACTGG + Intergenic
1051558686 9:18414513-18414535 AACAATGGTTTTTAAGAAACCGG + Intergenic
1051582264 9:18689712-18689734 CACACTGTGTCCAAAGCAACTGG - Intronic
1053694834 9:40627667-40627689 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1053941819 9:43258046-43258068 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1054270007 9:63012452-63012474 CACACTGAGGCTCAAGAAAAGGG + Intergenic
1054306078 9:63426891-63426913 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1054404820 9:64750870-64750892 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1054438444 9:65236362-65236384 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1054491960 9:65785586-65785608 CACACTGAGGCTCAAGAAAAGGG + Intergenic
1057142493 9:92735786-92735808 CACACTGGGTCTGGAGTCACTGG + Intronic
1057406087 9:94771929-94771951 CAGTCTAGGTCTTAACAAACAGG - Intronic
1058596941 9:106625115-106625137 TACACTGGGTCTTGAAAAATTGG + Intergenic
1059788686 9:117616197-117616219 CACACTAAGGCTTAAGACACTGG - Intergenic
1061715178 9:132514411-132514433 CAGACTGGGTGTTAGGAGACTGG - Intronic
1202777279 9_KI270717v1_random:1273-1295 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1189712467 X:43827531-43827553 CAGCCTAGGCCTTAAGAAACTGG - Intronic
1197849514 X:130842778-130842800 AACACTGGCACTTAAGAAATGGG - Intronic
1199086839 X:143636896-143636918 CACACTGGTCCTGAAGAAATGGG - Intergenic
1201192637 Y:11459619-11459641 CACACTGAGGCTCAAGAAAAGGG - Intergenic
1202216781 Y:22500762-22500784 CACACTGGGTCTTATGTGGCTGG - Intronic
1202326406 Y:23695308-23695330 CACACTGGGTCTTATGTGGCTGG + Intergenic