ID: 1022920334

View in Genome Browser
Species Human (GRCh38)
Location 7:35006550-35006572
Sequence TCTGTGGCTAAGAAATATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022920329_1022920334 20 Left 1022920329 7:35006507-35006529 CCACACACTGGGTCTTAAGAAAC 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1022920334 7:35006550-35006572 TCTGTGGCTAAGAAATATCAGGG No data
1022920331_1022920334 -6 Left 1022920331 7:35006533-35006555 CCTTCAGAAACTGTTAGTCTGTG 0: 2
1: 0
2: 1
3: 11
4: 199
Right 1022920334 7:35006550-35006572 TCTGTGGCTAAGAAATATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022920334 Original CRISPR TCTGTGGCTAAGAAATATCA GGG Intronic
No off target data available for this crispr