ID: 1022922261

View in Genome Browser
Species Human (GRCh38)
Location 7:35027385-35027407
Sequence CCGAACTACAAAGCCTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022922261 Original CRISPR CCGAACTACAAAGCCTTGGT AGG Intronic
908009454 1:59761230-59761252 GCGAACTCCAAAGCCTGGGTTGG - Intronic
915244633 1:154547649-154547671 GAGAAAGACAAAGCCTTGGTGGG - Exonic
917226706 1:172791123-172791145 CTTAACTCCAAAGCCTTGGGTGG + Intergenic
1065287344 10:24198891-24198913 CCGAACTACTAGGCCTTAGGAGG + Intronic
1083130019 11:60616354-60616376 CTGACCTACAAAGCTTTAGTAGG + Intergenic
1093380518 12:18485983-18486005 CTGAACTACAAAGTTTTGGGTGG - Intronic
1109882143 13:68493622-68493644 CAGATCTACAAAGCCATGGGTGG + Intergenic
1118612028 14:67548880-67548902 CTGAACTACAAATTTTTGGTAGG - Intronic
1120976919 14:90256900-90256922 CCGATCAGCAAAGCCCTGGTCGG - Intronic
1130107517 15:80940210-80940232 CTGAACTGCAAAGCCCTGGAAGG - Intronic
1137684662 16:50378350-50378372 CCGAATTACAGAGCCGTGGAAGG - Intergenic
1144264434 17:13554642-13554664 TCGAACTAGATTGCCTTGGTAGG - Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149083280 17:52683893-52683915 CTGTACAATAAAGCCTTGGTAGG + Intergenic
1156346338 18:36260284-36260306 CTTAACTACAAAATCTTGGTGGG + Intronic
1158125558 18:54096222-54096244 TCGACCTACAGAGCCTTGGAGGG + Intergenic
931184269 2:59934582-59934604 CCCACCTACAAAGCTTTTGTGGG - Intergenic
932605115 2:73160245-73160267 CTGAACCACAAAGCCTGGATTGG + Intergenic
945830137 2:214774586-214774608 TAGAACAACAAAGCCTGGGTGGG - Intronic
1181804069 22:25364645-25364667 ACCAGCTACAGAGCCTTGGTAGG + Intronic
970787193 4:19813563-19813585 CCGAAATACAAAGCATTGTGTGG + Intergenic
976478427 4:85511334-85511356 CCTAACTCCAAAGCCTTCGGAGG - Intronic
990189993 5:53249216-53249238 CCTCACTACAAAGCCCTGGCTGG + Intergenic
994033661 5:95174113-95174135 CAGAATTACAATGCCTTGCTAGG + Intronic
996442306 5:123505890-123505912 CTGAGATACAAAGCTTTGGTAGG + Intergenic
1000231419 5:159318924-159318946 CTGAACTCCAAAGCCTTATTAGG - Intronic
1004163941 6:13239125-13239147 CAGATCCACAAAGCCTGGGTGGG + Intronic
1004803876 6:19180856-19180878 CTGAGCTACAAATCCTTGGACGG + Intergenic
1014266485 6:119283785-119283807 CTGAATTACAAAGGCTTTGTAGG + Intronic
1017201590 6:151760315-151760337 ACCAACTACAATGCCTTGTTGGG - Intronic
1022922261 7:35027385-35027407 CCGAACTACAAAGCCTTGGTAGG + Intronic
1042389311 8:68214793-68214815 TGGAAATACAAGGCCTTGGTTGG + Intronic
1044734123 8:95260349-95260371 TTGAACAACAAAGCATTGGTTGG - Intronic
1058126987 9:101206676-101206698 CCCAACTACAACACCTAGGTAGG + Intronic
1193921707 X:87435979-87436001 CTGATCTACAAAGCTTTGTTTGG + Intergenic
1199930767 X:152518549-152518571 CAGAATTACAAAGCATTGTTGGG + Intergenic