ID: 1022922727

View in Genome Browser
Species Human (GRCh38)
Location 7:35032883-35032905
Sequence CTGTGGAGATGGAGAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1124
Summary {0: 1, 1: 4, 2: 20, 3: 193, 4: 906}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022922727_1022922730 -5 Left 1022922727 7:35032883-35032905 CCAATTTCTCTCCATCTCCACAG 0: 1
1: 4
2: 20
3: 193
4: 906
Right 1022922730 7:35032901-35032923 CACAGCCACCGCCTTCATCTAGG 0: 1
1: 1
2: 1
3: 27
4: 245
1022922727_1022922734 15 Left 1022922727 7:35032883-35032905 CCAATTTCTCTCCATCTCCACAG 0: 1
1: 4
2: 20
3: 193
4: 906
Right 1022922734 7:35032921-35032943 AGGCCAGCAACCCTCTTGCTAGG 0: 1
1: 0
2: 1
3: 7
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022922727 Original CRISPR CTGTGGAGATGGAGAGAAAT TGG (reversed) Intronic
900606047 1:3524012-3524034 CTGTGGACATGGAGAGGCAGAGG - Intronic
902404702 1:16176224-16176246 ATGATGAGATGGAGAGAGATAGG - Intergenic
902736339 1:18403775-18403797 GTGTGGAGATGGACAGACATAGG - Intergenic
902763315 1:18598541-18598563 CTGTGCTGAAGGAGAGGAATAGG - Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903297206 1:22351324-22351346 CTGGGAAGATGCAGAGAAAAAGG + Intergenic
903561118 1:24228626-24228648 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
903662970 1:24989941-24989963 CACTGGAGGTGGGGAGAAATGGG + Intergenic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904037722 1:27567787-27567809 CTGTGAAGAGGGAGAGATGTTGG - Intronic
904202486 1:28830097-28830119 CTGAGGAGAGGGAGAGAGATGGG + Intronic
904378686 1:30097074-30097096 CTGTGGTGGTGTTGAGAAATTGG + Intergenic
904865357 1:33574666-33574688 CTGTTCAGAGGGAGAGAAGTTGG + Intronic
905361582 1:37424512-37424534 CTGTGGAGTGGGAGAGAGAAAGG - Intergenic
905506908 1:38487181-38487203 GTGAGGAGATGGGGAGAGATTGG - Intergenic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906078837 1:43070370-43070392 CTGTGGTGATGGGGAGACAGCGG - Intergenic
906113364 1:43339006-43339028 ATGGGGATATGGAGAGAAAAAGG + Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
907191843 1:52655930-52655952 CCTTGAGGATGGAGAGAAATGGG + Intronic
907649376 1:56280060-56280082 CTGGGGAGAGGGAAAGAGATGGG + Intergenic
907652367 1:56307565-56307587 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
907802480 1:57783894-57783916 CTGAAGAGAAGGAGAGAGATTGG - Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
908037068 1:60067297-60067319 TGGTGAAGATGTAGAGAAATAGG - Intronic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908333261 1:63093073-63093095 CTCAGGAGAGGGAGAGAGATGGG + Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908958391 1:69664441-69664463 CTGGCGAGATGTGGAGAAATGGG - Intronic
910151536 1:84153092-84153114 CCAAGGAGAGGGAGAGAAATGGG + Intronic
910174979 1:84419919-84419941 ATTTGGAGCTGGAGAGAAAAGGG - Intergenic
910239767 1:85073918-85073940 GTGTGGAGGTGGGGAGAAAGTGG + Intronic
910298419 1:85676639-85676661 CTGAGGAGAGTGAGAGAGATGGG + Intronic
911493970 1:98607569-98607591 ATATGGAGATAGAGAAAAATAGG + Intergenic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
911759088 1:101596352-101596374 CTGAGTAGAGGAAGAGAAATAGG + Intergenic
911766445 1:101681263-101681285 CTTTAGAGACGGAGAAAAATTGG + Intergenic
912149411 1:106839220-106839242 CTATGGAGTTGGAGGGAACTGGG - Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912663772 1:111560840-111560862 TTGGGAGGATGGAGAGAAATTGG - Intronic
912718174 1:111997133-111997155 AGGAGGAAATGGAGAGAAATGGG - Intergenic
912859908 1:113204665-113204687 TTGTGGATATGGTGAGAGATAGG + Intergenic
912902512 1:113667864-113667886 CTGAGGAGAGGGAGAAAGATGGG + Intronic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
914356759 1:146892283-146892305 CTGTGGAGAAGCAGAAAAATGGG + Intergenic
914885377 1:151580212-151580234 CTGTAGTGAGGGAGAAAAATGGG + Intronic
915569889 1:156738765-156738787 CTGGGCAGATGGATAGAAACGGG + Intronic
915694783 1:157728854-157728876 CTGGAGAGATGTGGAGAAATAGG + Intergenic
916191587 1:162184159-162184181 CTGAGGAGAGGGAGAGAGATGGG + Intronic
916402644 1:164465792-164465814 TTGTGGAGATGGAGGGACAGAGG + Intergenic
916800204 1:168208718-168208740 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
916808808 1:168286861-168286883 TGGTGAAGATGTAGAGAAATTGG - Intronic
916825077 1:168435244-168435266 CTGGGGGGATGGAGAGCAACAGG - Intergenic
917866373 1:179199506-179199528 CTGTGAAGATGTAGAGAGATTGG - Intronic
917873667 1:179265662-179265684 TGGTGAAGATGTAGAGAAATTGG - Intergenic
917955734 1:180095811-180095833 CTTTGGAAATGGAAAGAATTAGG + Exonic
918127346 1:181596108-181596130 CCGGGGAGATTGAGAGAAAGAGG + Intronic
918152056 1:181806086-181806108 CCTGGGAGATGGAGAGAAAGAGG + Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918352326 1:183670134-183670156 GTGGGGAGATGGAGAGAGATAGG - Intronic
918422510 1:184378347-184378369 TTGTGAGGATGCAGAGAAATGGG + Intergenic
918498363 1:185165103-185165125 CTGAGGAGAGGGAGAGAGACTGG + Intronic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919072247 1:192771116-192771138 CTGTGAAAATGTAGAGAACTGGG + Intergenic
919436051 1:197562634-197562656 CTGAGGAGAGGGAGAGAGATGGG - Intronic
919598887 1:199599001-199599023 CAGGGGAGACGAAGAGAAATTGG + Intergenic
919751018 1:201038309-201038331 CTGTGGAGAGGCAGAGAGAGGGG + Intergenic
920047704 1:203144301-203144323 CTGTGGATATAGAGATGAATAGG - Intronic
921225995 1:213019870-213019892 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
922659155 1:227414082-227414104 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923260594 1:232264368-232264390 CTGCAGAGATGGAGAAAAAATGG - Intergenic
923294116 1:232576482-232576504 CTGAGGAGAGAGAGAGAAATGGG - Intergenic
923374642 1:233348630-233348652 CAAGGAAGATGGAGAGAAATCGG - Intronic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
923893473 1:238241466-238241488 ATGTGGAAATGGAGAGAATGGGG + Intergenic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924292270 1:242548565-242548587 GTGAGGAGATGGAGAGATGTGGG + Intergenic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
924661835 1:246026707-246026729 CTGAGGAGAGGGAGAGAGACAGG - Intronic
1062890229 10:1053937-1053959 CTGAGCAGAAGGAGAGAGATAGG + Intronic
1063337278 10:5228183-5228205 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1063623314 10:7667512-7667534 CTGGGGAGGTGGGGGGAAATGGG - Intergenic
1063889445 10:10614652-10614674 CTGTTGACAGGGAGAGAGATGGG + Intergenic
1064484911 10:15776359-15776381 TGGTGAAGATGGGGAGAAATTGG - Intergenic
1065030653 10:21582655-21582677 TAGTGGAGATGGAGAGAGAGAGG + Intronic
1065111589 10:22445221-22445243 AACTGGAGAAGGAGAGAAATGGG + Intronic
1065645294 10:27827630-27827652 CCCTGGAGATGAAGAGAAATGGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1065886825 10:30085671-30085693 CAGTGGAGATGGGGAGTGATAGG + Intronic
1066036102 10:31486358-31486380 CTGTGGCCATGTAGAGAAAGTGG - Intronic
1066043360 10:31575628-31575650 CTGAGGAGAGGGAAAGAGATGGG - Intergenic
1066290359 10:34008744-34008766 CTAGGGTGATGGAGAGGAATGGG + Intergenic
1066331188 10:34425114-34425136 CAGTAGAGATGGAAAAAAATTGG - Intronic
1066520950 10:36218291-36218313 TTGTTGAGATGTTGAGAAATAGG + Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068090534 10:52427645-52427667 CAGTGGAGAGGGAGATATATGGG - Intergenic
1068248283 10:54402799-54402821 CTGAAGAGATGGAGAAAGATGGG - Intronic
1068559716 10:58500074-58500096 ATGTTGGGATGGAGAGAATTAGG - Intergenic
1068627620 10:59266286-59266308 ATGTAGAGATGTAGAGAATTTGG + Intronic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1070242918 10:74701220-74701242 CTGTGGAGATGGACTAGAATTGG + Intronic
1070372609 10:75797950-75797972 TTGGGGGGATGTAGAGAAATTGG - Intronic
1070420796 10:76235179-76235201 CTGGGGAGAGAGAGAGAGATGGG + Intronic
1070438460 10:76416767-76416789 CTGGGGAGATGAAGTGGAATAGG - Intronic
1070858967 10:79633679-79633701 TTGTAGAGATGTAGATAAATAGG + Intergenic
1071374867 10:84992083-84992105 CTGTGGAGATGGAGTCATAGAGG - Intergenic
1071400838 10:85268976-85268998 TTGAAGAGAAGGAGAGAAATGGG + Intergenic
1071851653 10:89577742-89577764 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1072344481 10:94489761-94489783 CTGAAGAGATAGAGAGAGATGGG + Intronic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1073772292 10:106748479-106748501 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1074210699 10:111331537-111331559 CTGAGGAGATGGAGGGAGACAGG - Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074691462 10:116008720-116008742 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1075969535 10:126640718-126640740 CTCTGGACAAGGAGAGAGATAGG + Intronic
1076205922 10:128602760-128602782 CTGAGGAGAGGGAGAGAATTGGG - Intergenic
1076262294 10:129076424-129076446 CACAGGAGATGGAGAGAGATAGG - Intergenic
1076734852 10:132454150-132454172 TTGTGGAGTTGGAGAGAGTTAGG - Intergenic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077067125 11:646556-646578 CTGTGCAGATGGAGGGAGAGAGG + Intronic
1077263758 11:1638506-1638528 CCCTGGAGAGGGAGAGAGATAGG - Intergenic
1077347306 11:2068835-2068857 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077980217 11:7292523-7292545 GTGTGGAGTTGGAGGGGAATGGG - Intronic
1078193665 11:9115889-9115911 CTGAGGAGAGGGGGAGAGATGGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078442594 11:11379675-11379697 CGATGGAGATGGAGACCAATAGG - Intronic
1078822260 11:14894007-14894029 CGTGGGAGATGGAGAGAAATTGG - Intergenic
1078995879 11:16698751-16698773 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1078999258 11:16737716-16737738 CTGGAGAGAGGGCGAGAAATGGG + Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079138263 11:17788752-17788774 CTGAGGAGATGGAAAAATATGGG - Intronic
1079303680 11:19303420-19303442 CTGAGGAGACGGAGAGAGATGGG + Intergenic
1079689987 11:23406181-23406203 CTATGGAAATGGAAAGAAAGAGG - Intergenic
1079748326 11:24161430-24161452 TTGTGAAGATGCAGAGAAAAGGG + Intergenic
1079869145 11:25774280-25774302 CGGTGAGGATGTAGAGAAATTGG - Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1081039298 11:38191401-38191423 CTGTGGAGATGGCAAACAATGGG + Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1081430514 11:42971681-42971703 GTGTGGAGAAAGAGAGAGATGGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082988557 11:59187827-59187849 CTGGGGAGAAGGACAGAAAGGGG + Intronic
1083976049 11:66121308-66121330 CTGAGGAGAGGAAGAGAGATGGG - Intronic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084443853 11:69192038-69192060 CTGTTGAGAGGTAGAGAAACAGG - Intergenic
1084557927 11:69885841-69885863 GTGGGGAGATGGAGAGTGATCGG + Intergenic
1084583191 11:70037317-70037339 CTGTGGAGAAAGAGAAGAATTGG + Intergenic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085372964 11:76028277-76028299 TTGAGGAGAGGGAGAGAGATGGG - Intronic
1085534460 11:77209674-77209696 AGGTGGTGATGGAGAGACATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086318608 11:85620299-85620321 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1086500803 11:87451423-87451445 CTGTAGAGATAGACAAAAATAGG - Intergenic
1086896968 11:92324454-92324476 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1087295613 11:96369510-96369532 CTGAGGAGAGGAAGAGAGATGGG + Intronic
1087422262 11:97944591-97944613 TTGTGAAGATGTGGAGAAATTGG - Intergenic
1087913954 11:103786394-103786416 CAGAGGAGAGGGAGAGAGATGGG + Intergenic
1088254741 11:107892638-107892660 CTGGCAAGATGTAGAGAAATTGG + Intronic
1088567875 11:111192130-111192152 CAGAGGAGAGGGAGAGACATGGG - Intergenic
1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG + Intronic
1089061857 11:115632256-115632278 CCTTGGAGAAGGAGAGGAATGGG + Intergenic
1089253431 11:117181096-117181118 CTGTGCACATGGATAGGAATGGG + Intronic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089605421 11:119638673-119638695 CTGCGGGGAGGGAGAAAAATGGG - Intronic
1089918245 11:122180737-122180759 CTGGAGAGAGGGAGAGAAACAGG - Intergenic
1090147786 11:124345098-124345120 CTGAGGAGAGGGAGAAAAATGGG - Intergenic
1090338570 11:125993865-125993887 TTGTAGAGATGCTGAGAAATTGG - Intronic
1090715837 11:129430035-129430057 CTGTGGAGGTGGTCACAAATTGG - Intronic
1090813107 11:130265102-130265124 CTGAGGAGGAGGAGAGAGATGGG - Intronic
1091110064 11:132957868-132957890 CTGAGGAGAAGGAGAGAGACTGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091871358 12:3893824-3893846 GTGTAGAGAAGGAGAGAAACGGG - Intergenic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092334310 12:7615240-7615262 TTGGGGAAATGGAGAGATATTGG + Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1093427536 12:19045382-19045404 CTGAGGAGATGGAGAAAGACAGG - Intergenic
1093569292 12:20647685-20647707 CTGTGGAAATGAACAGCAATGGG - Intronic
1093711279 12:22333026-22333048 CTGGGGAGGTGGAGAGGAAGGGG + Intronic
1094280111 12:28727559-28727581 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1094280686 12:28734271-28734293 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1094361349 12:29634558-29634580 CAGTAGTGATGGAGTGAAATCGG + Intronic
1095168757 12:39007697-39007719 CTAAGGAGAGGGAGAGAAAAGGG - Intergenic
1095282264 12:40367755-40367777 CTGTTGAGTAAGAGAGAAATAGG + Exonic
1095753062 12:45730767-45730789 CTATGGAGATGGATAGATCTGGG + Intronic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096259041 12:50079652-50079674 CGATGTAGATGGAGAGAACTAGG - Intronic
1096398594 12:51286757-51286779 CTGTGCTGATGGAGAGAGATAGG - Intronic
1096432136 12:51554724-51554746 CTGAGGAAAGGGAGAGAGATGGG + Intergenic
1096440326 12:51637204-51637226 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1096561271 12:52437670-52437692 CTGTGGAGGAGGAGAGGAAGTGG + Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097123668 12:56755564-56755586 CTGAGGAGAGGGAGAGAGAGAGG + Intronic
1097193299 12:57230497-57230519 CTCTGGAGTTGGGGAGACATAGG + Intronic
1097625258 12:61992338-61992360 CTGTGGAGTGTGAGAGAAAGAGG - Intronic
1097652842 12:62323094-62323116 CAATGGACATTGAGAGAAATAGG - Intronic
1097788607 12:63789256-63789278 CCAAGGAGATGGGGAGAAATGGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1098789125 12:74798103-74798125 CTGTGGAGATGGTAAGAGTTGGG + Intergenic
1098948160 12:76610569-76610591 ATGGGTAGTTGGAGAGAAATTGG - Intergenic
1099183569 12:79494186-79494208 CTGGAGAGATGTGGAGAAATAGG - Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099461369 12:82925762-82925784 CCATGGAAAGGGAGAGAAATTGG - Intronic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100927299 12:99563456-99563478 CTGAGGAGAGGAAGAGAAATAGG + Intronic
1100927771 12:99569313-99569335 CTGGGGAACTGGACAGAAATTGG + Intronic
1101327790 12:103731874-103731896 CTGGGGAGAGGGAAAGAAATTGG + Intronic
1101444634 12:104728838-104728860 GTGTGGAGATGGACAGAAAGGGG + Intronic
1101580659 12:106038585-106038607 CCGTGGAGTTAGAGAGAACTGGG + Intergenic
1101606991 12:106254702-106254724 CTGTGGAGGTCATGAGAAATGGG - Intronic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101766580 12:107706031-107706053 CTGGAGAGATGTGGAGAAATAGG - Intronic
1102570561 12:113824792-113824814 CCGTGGAGATGATGAGAAACGGG - Intronic
1102726080 12:115066297-115066319 CTTTCGAGATGGAGGAAAATGGG - Intergenic
1102739070 12:115190085-115190107 TTGTGGAGAGGAAGAGGAATGGG - Intergenic
1103082741 12:118038287-118038309 CTCTGCAGCTGGAGAGAAGTCGG - Exonic
1103142848 12:118565421-118565443 ATGTGGAGAAACAGAGAAATTGG + Intergenic
1103187963 12:118977950-118977972 CTGTGGATTTAGAGAGAACTAGG - Intergenic
1103226291 12:119290885-119290907 GTGTGGAGAGGGGAAGAAATTGG - Intergenic
1103250595 12:119496637-119496659 CCGTGAAGATGAAAAGAAATGGG - Intronic
1103325243 12:120116311-120116333 CTCTGGAGTTGGAGAGACGTGGG - Intronic
1103605050 12:122079762-122079784 TTGTGGGGATGGAGTGAGATAGG + Intronic
1103648700 12:122416243-122416265 CTGAACAGATGGATAGAAATAGG + Intronic
1103948913 12:124541218-124541240 AGGTGGAGATGGAGGGAGATGGG + Intronic
1103965924 12:124639273-124639295 CTGGGGAGATGCAGAGATTTTGG - Intergenic
1104501740 12:129292957-129292979 CAGTGGAGAAGTAGAGATATTGG + Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104635277 12:130434653-130434675 CCGTGGAGATCAAGAGACATGGG - Intronic
1104805445 12:131586581-131586603 CAGTGGAGCTGGGGAGAAACGGG + Intergenic
1104949920 12:132435063-132435085 CTGAGGAGAGGGAGAGGGATGGG + Intergenic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1105589642 13:21779465-21779487 CTGAGAAGAAGGAGAGAGATTGG - Intergenic
1105599729 13:21875984-21876006 CTCTGGGGATAGAGAAAAATGGG + Intergenic
1105619848 13:22056172-22056194 CCATGGGGGTGGAGAGAAATGGG + Intergenic
1105774713 13:23646920-23646942 TGGTGGAGATGTGGAGAAATTGG - Intronic
1105780060 13:23697763-23697785 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1106000216 13:25715493-25715515 CTGGGGAACTGGAGAGACATTGG - Intronic
1106045569 13:26137257-26137279 CTGAGGTGATGGATAGCAATTGG + Intronic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106769222 13:32945418-32945440 CCTTGGAGATGGGGAGAAATGGG + Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107148702 13:37087708-37087730 ATGTGGAAATGGAGGCAAATTGG + Intergenic
1107713003 13:43169126-43169148 CTGAGTACATGGATAGAAATAGG - Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108166563 13:47699423-47699445 CTGTGGAAAGGGAGAGGAAGAGG - Intergenic
1108305124 13:49123853-49123875 CTGGAGAGATGTGGAGAAATAGG + Intronic
1108979293 13:56490362-56490384 TTGAGGAGAGGGAGAGAATTGGG - Intergenic
1109276898 13:60313557-60313579 CTGTAGATAAGAAGAGAAATTGG + Intergenic
1109333314 13:60959329-60959351 CTGTGGAGTTGGACAGACCTTGG + Intergenic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1109893460 13:68650913-68650935 CTGAGGAGAGGGAGAGAGACGGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1110661498 13:78063267-78063289 CCATGGAGATAAAGAGAAATAGG - Intergenic
1110746252 13:79056919-79056941 CTGAAGAGAGGGAGAGAGATGGG - Intergenic
1110766495 13:79285149-79285171 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1110946792 13:81431535-81431557 CTGAGGAAAGGAAGAGAAATGGG - Intergenic
1111247737 13:85562946-85562968 AGTTGGGGATGGAGAGAAATGGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111640517 13:90963853-90963875 CCGAGGAGAAGGAGAGAGATGGG - Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1111718822 13:91916157-91916179 TTGTAGAGATGCAGAGAAAGTGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112521151 13:100096422-100096444 CTGAGGAGAGGGAGAGACATAGG - Intronic
1112653036 13:101418979-101419001 CTGGGGACATGGAGGCAAATGGG - Intergenic
1112728806 13:102335986-102336008 CTGGGGAGAGGGAAAGAGATGGG - Intronic
1113342032 13:109435223-109435245 TTCTGGAGATGTAAAGAAATAGG + Intergenic
1113438787 13:110312447-110312469 CTGGGGAGAGGGAAAGAAAATGG + Intronic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1113737511 13:112689504-112689526 CTCTGCAGATGGAGAGACACAGG - Intergenic
1114361019 14:21972801-21972823 CGGTGAGGATGTAGAGAAATAGG + Intergenic
1114409320 14:22485996-22486018 CAGAGGAAATGGAGAGAGATGGG + Intergenic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1114794081 14:25692667-25692689 TTGTGAAGATGGAGAGCAAGGGG + Intergenic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115468594 14:33744319-33744341 CTGAGGAGAGGGAGAGAGACTGG + Intronic
1115469306 14:33752013-33752035 TTGGGGAGAAGGAGAGAAAGGGG - Intronic
1115604560 14:34987440-34987462 CTCAGGAGATGGAGTAAAATAGG - Intronic
1115756320 14:36529040-36529062 ATGTGGAAATGGAGACAGATTGG - Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116088006 14:40266294-40266316 CTGAGGGGATGTGGAGAAATAGG + Intergenic
1116499467 14:45602676-45602698 CTGAGGAGAGGGAGACAGATGGG + Intergenic
1117165543 14:53029048-53029070 CTTTGGACAGGGAGAGAAACTGG + Intergenic
1117195299 14:53334217-53334239 ATATGGAGATGGAGACATATGGG - Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117296283 14:54382618-54382640 CTATGAAGAAGGAGAGAGATGGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117519542 14:56537095-56537117 CTGAGGAGAGGGAGAGAGACAGG - Intronic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117705514 14:58463216-58463238 GTGAGGAGATGGAGAGGAACAGG - Intronic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119885001 14:78132837-78132859 CAGGGGAGATGCAGAGATATTGG + Intergenic
1120262590 14:82205653-82205675 CGGTGAAGATGGGGAGAAAAGGG - Intergenic
1120844892 14:89117037-89117059 TTGTGGACAGGGAGGGAAATTGG - Intergenic
1121141110 14:91543363-91543385 GTGTGCAGCTGGAGGGAAATGGG - Intergenic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121656668 14:95601993-95602015 CTGTGGAGACAAAGAGAAAAAGG + Intergenic
1121827191 14:97019919-97019941 ATGGGGAGATGGGGAGAAATTGG - Intergenic
1122043082 14:99003708-99003730 TTCTGGAGATGGACAGAATTGGG - Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122662577 14:103307649-103307671 CTGAGGAGTTGGAGAGAGATGGG + Intergenic
1123067188 14:105624665-105624687 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123071207 14:105643392-105643414 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123076169 14:105668435-105668457 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123090867 14:105741662-105741684 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123102818 14:105817306-105817328 ATGTGGATATCGACAGAAATAGG - Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123871605 15:24580668-24580690 CTGTGTACATGAAGAGATATGGG + Intergenic
1124255398 15:28137670-28137692 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124568912 15:30841952-30841974 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1124801607 15:32838385-32838407 CTCTTGAGATGCACAGAAATCGG - Intronic
1125104189 15:35951528-35951550 CTTAGGAGTTGGAGAGAAAGGGG + Intergenic
1125109248 15:36011703-36011725 CTAAGGAGAGGGAGAGAGATGGG + Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1126011480 15:44306757-44306779 CTGAGGAGAGGAAGAGAGATGGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126391699 15:48162865-48162887 CTGAGGCGACGGAGAGAGATGGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1126930890 15:53649803-53649825 TTGTGAGGATGTAGAGAAATTGG + Intronic
1127370653 15:58335973-58335995 CTGAGGAGATGGAGAAAGACAGG - Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128993999 15:72283377-72283399 CTGTGTGGAAGGGGAGAAATGGG - Intronic
1129101101 15:73264943-73264965 CGGTGCTGAGGGAGAGAAATGGG + Intronic
1129321593 15:74778004-74778026 CTGGGGAGATGGTGCGAGATGGG - Intergenic
1129601377 15:77000562-77000584 GTGGGGAAATGGAGAAAAATAGG + Intronic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129859876 15:78852582-78852604 TTGGAGAGACGGAGAGAAATTGG - Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130129831 15:81130837-81130859 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131836050 15:96392286-96392308 CTGTGAGGATGGAGTGAACTTGG + Intergenic
1131909948 15:97187307-97187329 CGGAGGAGATGAAGAGAGATGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1133757552 16:8773692-8773714 ATGGGGAGGTGGAGATAAATAGG - Intronic
1133864610 16:9630890-9630912 CTGTGCAGCTGGACATAAATTGG - Intergenic
1134875657 16:17696372-17696394 CTCTGGAGCTGGAGAGATTTGGG - Intergenic
1134883108 16:17764772-17764794 CTGTGGCAAAGCAGAGAAATAGG - Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135404143 16:22186103-22186125 CTCTGGAGTAGGAGAGAAAGAGG - Intronic
1135407219 16:22206907-22206929 ATGTGGATATGGAAAGCAATTGG + Intronic
1136237992 16:28926038-28926060 CGCTGGAGATGGAGAAAAAGGGG - Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136533465 16:30885234-30885256 ATGTGACGATGGAGAGAGATTGG + Intronic
1137900929 16:52268183-52268205 CCGAGGAGAGGGAGAGAGATGGG - Intergenic
1138033996 16:53584004-53584026 CTGTGAAGATGGAGGTCAATTGG + Intergenic
1138610711 16:58121748-58121770 TTGCGGGGAGGGAGAGAAATCGG - Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1138920387 16:61521462-61521484 TTATGGAGATGTGGAGAAATTGG + Intergenic
1138932773 16:61681032-61681054 TTGTGGAGACAGGGAGAAATTGG + Intronic
1139051092 16:63125324-63125346 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1139977255 16:70823170-70823192 CTGTGGAGAAGCAGAAAAATGGG - Intronic
1140259288 16:73363441-73363463 GTGAGGAGATGGAGATAAAATGG - Intergenic
1140439126 16:74973323-74973345 CTGGGGTGATGGAGAGAGACCGG - Intronic
1140897527 16:79338013-79338035 CTTGGGAGATGGAAATAAATAGG + Intergenic
1141248356 16:82331986-82332008 CTGTGGGGATGCACAGAAAAGGG + Intergenic
1142470542 17:161101-161123 CTGGGGAGATGGGGAGAGATGGG - Intronic
1142496859 17:310556-310578 ATGTGGAGATGGAGATAAACAGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143083991 17:4402251-4402273 ATGTGAAGATGGAGAGAGATTGG + Intergenic
1143168455 17:4911353-4911375 AGGGGGAGATGGAGAGAAAGAGG + Intergenic
1143479884 17:7222093-7222115 CGGAGGAGAAGGGGAGAAATGGG - Intronic
1143483132 17:7238509-7238531 CTGTGGAGAGAGAGAGAGAGTGG - Intronic
1144370801 17:14589743-14589765 CTGTGTTCAGGGAGAGAAATAGG + Intergenic
1144505279 17:15824149-15824171 CAGTGAAGATGTGGAGAAATCGG - Intergenic
1144645239 17:16969056-16969078 CGGTGAAGATGTGGAGAAATTGG + Intronic
1144742109 17:17589886-17589908 CTGTGCAGCTGGAGAGAGCTGGG - Intronic
1144967292 17:19085628-19085650 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1144980628 17:19166438-19166460 CCCTGGGGATGGAAAGAAATGGG - Intergenic
1144987594 17:19211795-19211817 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1145169456 17:20642023-20642045 CGGTGAAGATGTGGAGAAATCGG - Intergenic
1145277729 17:21444528-21444550 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1145713997 17:27002345-27002367 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1145726869 17:27137251-27137273 CTGAAGAGATGGAGAAAGATGGG - Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146838185 17:36129163-36129185 CTGAGGAGAAGGGGAGAGATGGG - Intergenic
1146890547 17:36503835-36503857 ATGTGGAAATGAAGAGAAAGAGG - Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148220109 17:45855178-45855200 ATGTGGTGATGGAGACAGATTGG + Intergenic
1148344886 17:46896705-46896727 GTCTGCAGATGGAGGGAAATAGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148768030 17:50050728-50050750 CTGTGGAGTTGGAGAAACCTGGG + Intergenic
1149003987 17:51785526-51785548 CAGTGAAGATGTAGAGAAAAGGG + Intronic
1149249162 17:54748361-54748383 ATTTGGATATGGTGAGAAATAGG + Intergenic
1149299412 17:55290593-55290615 CCAAGGAGAGGGAGAGAAATGGG - Intronic
1149626215 17:58082878-58082900 CTATGGAGAGGGAGAGGCATAGG - Intergenic
1149940918 17:60864893-60864915 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1150014272 17:61538050-61538072 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1150509350 17:65733182-65733204 CCAAGGAGATGGAGAGAGATGGG + Intronic
1150714907 17:67563867-67563889 ATGTGGGGAGAGAGAGAAATGGG + Intronic
1150825811 17:68473852-68473874 CTGGAAAGATGGAGAGAAACTGG + Intergenic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1150947982 17:69767855-69767877 CTGAGGAGAGGGAGACCAATGGG - Intergenic
1151119804 17:71780080-71780102 CTGAGAAGAGGGAGAGAGATGGG - Intergenic
1152042926 17:77916572-77916594 CTGTGGAGCTGCAGATCAATAGG + Intergenic
1153133183 18:1881397-1881419 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1153144161 18:2010236-2010258 CTTAGGAGAGGGAGAGAGATGGG + Intergenic
1153292801 18:3518220-3518242 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1153390575 18:4553246-4553268 TGGTGAAGATGCAGAGAAATTGG - Intergenic
1153546338 18:6209502-6209524 CAGTGAAGATGTGGAGAAATTGG + Intronic
1153605722 18:6829295-6829317 CTGTGGAGCTGGACTGAAATTGG - Intronic
1153871729 18:9327342-9327364 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1155469960 18:26181377-26181399 CTGAGGAGAGGGAGAGACACAGG - Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155692277 18:28639787-28639809 CAGTGAAGATGTGGAGAAATTGG - Intergenic
1155855199 18:30825488-30825510 TGGTTGAGATGGACAGAAATGGG + Intergenic
1156110632 18:33722109-33722131 CTGAAGAAAGGGAGAGAAATGGG - Intronic
1156168463 18:34453014-34453036 CTGAAGAGAGGGAGAGAGATGGG + Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157630759 18:49093008-49093030 CTGAGAAGAAGGAGAGAAATAGG + Intronic
1158372653 18:56827071-56827093 TTGCGGAGGTGGAGAGACATGGG + Intronic
1158674659 18:59507291-59507313 TTGTAGAAATGGAGAGACATAGG - Intronic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1159046016 18:63368898-63368920 TAGTGAAGATGTAGAGAAATTGG - Intergenic
1159332124 18:67009371-67009393 TTGAGGAGAGGGAGAGAGATGGG + Intergenic
1159514497 18:69440119-69440141 CTGAGAAGAGGGAGAGAAGTGGG + Intronic
1159623376 18:70665724-70665746 TTGTGAAGATGTGGAGAAATGGG - Intergenic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1160347888 18:78149855-78149877 CTGAGGAGAGGGAGGGAGATGGG + Intergenic
1160465818 18:79074783-79074805 CTGGGGAGGAGCAGAGAAATGGG + Intronic
1161274323 19:3407067-3407089 ATGGGGAGATGGGGAGAACTTGG + Intronic
1161625783 19:5325733-5325755 CTGAGGAGAAGGAGATGAATTGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162301594 19:9848007-9848029 CTGTGGACATGGAACGGAATGGG - Intronic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1162776456 19:12982779-12982801 ACATGGAGATGGAGAGACATGGG - Intergenic
1163028933 19:14530934-14530956 AGGTGGAGGTGGAGAGGAATGGG - Intronic
1163500985 19:17676042-17676064 CTGTGGAGAGAGACAGAGATAGG + Intronic
1164477940 19:28589702-28589724 CTGTTGAAAGGGAGAGAGATGGG - Intergenic
1164520027 19:28972144-28972166 GTGTGGAGCTGCAGAGACATTGG - Intergenic
1166405321 19:42517689-42517711 TTTTGAAGATGTAGAGAAATTGG + Intronic
1166559766 19:43724596-43724618 CAGTGGAAATGCTGAGAAATTGG + Intergenic
1166882204 19:45936431-45936453 GTGTGGACATGGAGCTAAATTGG - Exonic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167752075 19:51387450-51387472 CTGTGGGGAAGGGGAGAGATGGG + Intronic
1167850104 19:52194793-52194815 TTGTGAAGATGCAGTGAAATTGG + Intronic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
925663579 2:6228668-6228690 CAGTGAAGATGGTCAGAAATAGG - Intergenic
926027934 2:9560889-9560911 CTGTGGAACTGGAGGGTAATTGG - Intergenic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926284481 2:11477536-11477558 CTTTGGAGAAAAAGAGAAATCGG + Intergenic
926449977 2:12991213-12991235 CAGAGGAGAGGGAGAGAGATGGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926687790 2:15711333-15711355 ATGAGGGGATAGAGAGAAATCGG + Intronic
926803582 2:16684072-16684094 AAGTGGAGATGAAGAGAAACTGG - Intergenic
927334272 2:21903954-21903976 CTGGAGAGATGTGGAGAAATAGG - Intergenic
927439114 2:23097843-23097865 ATTTGGAGAAGGAGAGAAATTGG - Intergenic
927554457 2:24022410-24022432 CTGAGGAGATGGACAGGAAGTGG - Intronic
927727172 2:25434841-25434863 TGGTGAAGATGTAGAGAAATTGG - Intronic
928021533 2:27708693-27708715 CGGTAGAGATGGGGAGAGATGGG - Intronic
928443905 2:31316118-31316140 CTGTGGAAATGAAGAGACATGGG - Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929097615 2:38278842-38278864 CTGAGGAGAGGGAGAGTGATGGG + Intergenic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
929562556 2:42964788-42964810 CTGTGGAGAGGGACAGAGAGGGG + Intergenic
929749967 2:44700554-44700576 CTGGGGAGAGGGAGAGAGATGGG + Intronic
929811215 2:45190688-45190710 ATGGGGAGATGGAGAGCAACAGG - Intergenic
930127928 2:47817722-47817744 CTGAGGAGAGGGACAGAGATGGG + Intronic
930435513 2:51336224-51336246 CTTTGGAGAGGCAGAGTAATGGG + Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930793093 2:55355683-55355705 CTGTGCAGATGAAGAGGCATGGG + Exonic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931122054 2:59230999-59231021 CTGTGCTGATGAACAGAAATGGG - Intergenic
931279609 2:60777780-60777802 CTGAGGAGAGGGAGAGAGATGGG + Intronic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932207142 2:69893214-69893236 CTGGGGAGAGGGAGAGCATTGGG + Intergenic
932324936 2:70852563-70852585 TGGTGGATATGCAGAGAAATTGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932720531 2:74135879-74135901 CTGGGGAGATGGACAGGTATAGG - Intronic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
932857919 2:75257181-75257203 TTGTGAAGATGTGGAGAAATTGG - Intergenic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
934061654 2:88299844-88299866 CTGAGGAGAGGGAGAGAGAGAGG - Intergenic
935182114 2:100700747-100700769 CTGGGGTGATGGAGGGACATCGG - Intergenic
935305008 2:101728945-101728967 CTGTTGACATGAAGAAAAATTGG + Intronic
935585404 2:104796320-104796342 TTGTGGAGATGGAAAGGAACTGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936970339 2:118170730-118170752 CTGAGGAGATGGATGGAGATTGG - Intergenic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937776071 2:125776863-125776885 TTGTGGAGGCAGAGAGAAATGGG + Intergenic
938227668 2:129629958-129629980 ATGTGGATATAGAGAGAAATAGG - Intergenic
938413721 2:131087138-131087160 CTGTGGAGGAGGGAAGAAATAGG + Intronic
938562544 2:132487078-132487100 CTGAGGATAGGGAGAGAGATGGG + Intronic
938675481 2:133629487-133629509 CTGTGAAGCTGTGGAGAAATAGG + Intergenic
939017981 2:136923590-136923612 TAATGAAGATGGAGAGAAATTGG - Intronic
939238691 2:139531379-139531401 CTGTGTGGAAGGAGAGAGATTGG + Intergenic
939486568 2:142819921-142819943 CTGAGGAGAGGGAGAGAGACAGG + Intergenic
939507591 2:143067978-143068000 CTGTTGAGGTGAAGAAAAATTGG + Intergenic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
939857761 2:147381075-147381097 GTGTGAAGAAGGAGAGAAAGGGG + Intergenic
940807775 2:158207175-158207197 CTGTGTAGAAGTAGAGGAATGGG + Intronic
941369429 2:164645967-164645989 CTGTGGTGATTAAAAGAAATAGG - Intergenic
941503760 2:166313959-166313981 CTGAGGAAAGGGAGAGAGATAGG + Intronic
942677232 2:178440658-178440680 CTGGGAAAATGGAGAGAGATGGG - Intronic
942747788 2:179255106-179255128 CTGAGGAGAAGGAGAGAGACAGG - Intronic
942822379 2:180129876-180129898 CTGAGGAGAGGGGGAGAGATAGG + Intergenic
943740833 2:191406581-191406603 CCGAGGAGAGGGAGAGAGATGGG + Intronic
944091324 2:195915082-195915104 CTGGGGAGAGAGAGAAAAATAGG + Intronic
944529572 2:200653999-200654021 CTGAGGAGAGGGAGAGAAATGGG - Intronic
944702700 2:202260062-202260084 GTTGGGAGATGGACAGAAATAGG - Intergenic
944721593 2:202428249-202428271 GTGTGTAGAGAGAGAGAAATAGG - Intronic
944721598 2:202428307-202428329 GTGTGTAGAGAGAGAGAAATAGG - Intronic
944950416 2:204742401-204742423 CTGTGGAGCTGGAGATCGATGGG + Intronic
945654544 2:212607156-212607178 CAGTGGAGGTGGTAAGAAATGGG - Intergenic
945683810 2:212944862-212944884 ACCTAGAGATGGAGAGAAATTGG + Intergenic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
945945715 2:215993920-215993942 CTGGAGAGATGTGGAGAAATAGG + Intronic
946044353 2:216809450-216809472 CTGTGGAGTCAGAGTGAAATGGG + Intergenic
946143745 2:217713398-217713420 CTGTGTAGATGGGCAGAATTTGG - Intronic
946536164 2:220631290-220631312 CTTTGCATATGGAGAGAAAGGGG + Intergenic
946901246 2:224374016-224374038 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
946950699 2:224871398-224871420 CAAGGGAGAAGGAGAGAAATGGG - Intronic
947101029 2:226621503-226621525 ATGGGGAGGTGGAGAGAAACAGG - Intergenic
947787659 2:232838316-232838338 GTGTGTATATAGAGAGAAATAGG + Intronic
947968271 2:234300659-234300681 ATGTGGAGATGCGGAGAAAAGGG + Intergenic
948193950 2:236081109-236081131 CTGTCTGGATGGAAAGAAATAGG - Intronic
948202964 2:236142992-236143014 ATCTGGAGATGGAGACAGATGGG + Intergenic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948670633 2:239566472-239566494 CAGTGGAGATGAAGAGAGACAGG + Intergenic
948822416 2:240556883-240556905 CTGTGAAGATGGAGACAGCTTGG + Intronic
948955044 2:241282801-241282823 ATGAGGAGAGGGAGAGAGATGGG - Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169485196 20:6024495-6024517 CTGAGGAGAGGGAGAGTGATAGG - Intronic
1169653886 20:7900656-7900678 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1169836702 20:9888278-9888300 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1169843492 20:9965140-9965162 CAGAGGAGATGAGGAGAAATGGG + Intergenic
1169864835 20:10188687-10188709 CTGGGGATATGGAAACAAATTGG - Intergenic
1170287368 20:14724998-14725020 TTCTGGAGATGGAGACAAATGGG + Intronic
1170544424 20:17422916-17422938 CTATGCACATGGGGAGAAATAGG + Intronic
1170546513 20:17439430-17439452 GTGAAGAGATGGAGAAAAATGGG - Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171251342 20:23651016-23651038 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1172236349 20:33378265-33378287 CTGAGGAAAGGGAGAGAGATGGG + Intronic
1172430970 20:34891444-34891466 CTGTTGAGATGGTAAGAAAGAGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172818083 20:37705807-37705829 TTGTGTAGCTGTAGAGAAATTGG + Intronic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1173768228 20:45633199-45633221 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1173910497 20:46665874-46665896 CTGGGAAGATGTAGAGAAACTGG - Intronic
1173910723 20:46668047-46668069 CTGAGGAGAGGGAGAGAGATTGG - Intronic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174273005 20:49383237-49383259 TTGTGGGGATGGAAAGCAATGGG - Intronic
1174745474 20:53057862-53057884 TTGAGGACATGGACAGAAATGGG + Intronic
1174986027 20:55452820-55452842 CTGAGGAGACAGAGAGAACTGGG + Intergenic
1175025584 20:55899006-55899028 CTTAGGAGAGGGAGGGAAATGGG + Intergenic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1176946046 21:14982995-14983017 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177286300 21:19055768-19055790 CTGAGGAGAGGGAAAGAGATAGG - Intergenic
1177331493 21:19670089-19670111 GTGAGGAGAGGGAGAGAGATGGG + Intergenic
1177519570 21:22201096-22201118 CTGTGCAGAGCGAGAGAAAGGGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178040932 21:28640276-28640298 CTGGGGAGATGGAGACACAATGG + Intergenic
1178384599 21:32138875-32138897 CTGCTGAGATGGGGAGAAGTGGG + Intergenic
1178437200 21:32570377-32570399 CTGAGGGGAGGGAGAGAGATGGG - Intergenic
1178596858 21:33962161-33962183 GAGTGGAGTTGGAGAGAAACAGG + Intergenic
1178742277 21:35212949-35212971 CTGTGGATTTGGAGATTAATTGG + Intronic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1181088330 22:20455268-20455290 CTGTGGAGCTGGAGGGAGATGGG - Intronic
1181498914 22:23304702-23304724 CGGTGAGGATGTAGAGAAATGGG - Intronic
1181520326 22:23444836-23444858 CTAAGGAGAAGGAGAGAGATGGG + Intergenic
1181970978 22:26689848-26689870 AGGAGGAGAAGGAGAGAAATGGG - Intergenic
1182489765 22:30663729-30663751 CTGTGGATATGGTCAGCAATAGG + Exonic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182726573 22:32451735-32451757 AGGTGGAGATGGGGAGAAACAGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183299586 22:37052222-37052244 CTGTGGACAGGGAGAGACCTGGG + Intronic
1183954544 22:41371494-41371516 GTCTGGAGATGGAGAGAGAGGGG - Intronic
1184011284 22:41750554-41750576 GTGTGGGGAAGGTGAGAAATGGG + Intronic
1184142077 22:42583786-42583808 CTGTGCAGAAGGAGAGGAAGGGG - Exonic
1184831212 22:46989545-46989567 CCGAGGAGAGGGAGAGAGATGGG + Intronic
1185096933 22:48814003-48814025 CAGAGGAGAGGGAGAGAGATGGG - Intronic
949623234 3:5839494-5839516 CTGAAGAGAGGGAGAGAGATGGG + Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950130026 3:10536007-10536029 CGATGAAGATGCAGAGAAATTGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950700326 3:14740296-14740318 CCAAGGAGATGGAGAGAAACAGG + Intronic
951245586 3:20337774-20337796 CAGTGGACTTGGAAAGAAATGGG + Intergenic
951422344 3:22502225-22502247 GTGGGGAGATGGAAAGAAACAGG + Intergenic
951476455 3:23111625-23111647 CTGAAGAGATGGAAAGAACTTGG + Intergenic
952113405 3:30150885-30150907 CTTAGGAGAGGGAGAGTAATAGG - Intergenic
952201187 3:31129577-31129599 CTGAGGAGAGGGAGAGAAACAGG + Intergenic
952552859 3:34498600-34498622 TGGTGGAGACGTAGAGAAATAGG + Intergenic
952809959 3:37393103-37393125 CTGAGGAGAGGGAGAGAGACTGG - Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
953005963 3:38979680-38979702 CAGTGGAGATAGAGAGACTTTGG - Intergenic
953174443 3:40537022-40537044 CTGAGGAGAGGGAGAGAGATGGG - Exonic
953483968 3:43277011-43277033 CTGAGGAAAGGGAGAGAGATGGG - Intergenic
953591989 3:44266578-44266600 CTAAGGAGAGGGAGAGAGATGGG + Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953882857 3:46700621-46700643 CTGAGGAGATGTAGAGACCTGGG - Intergenic
954503556 3:51045273-51045295 CTGAGGAGAGGGAAAGAGATAGG + Intronic
954576910 3:51681368-51681390 CTGGAGTGATGGAGAGAGATGGG + Intronic
955072627 3:55584561-55584583 GTGTGGAGATGGTGAGGCATTGG + Intronic
955083054 3:55675558-55675580 CTGTGGAGATGGTTGGAAAGAGG + Intronic
955211156 3:56942505-56942527 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955262730 3:57410457-57410479 CTGAGAAGAGGGAGAGAGATGGG - Intronic
955290344 3:57686770-57686792 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955354438 3:58218992-58219014 CTGAGGAGAGGAAGAGAGATGGG - Intergenic
955416614 3:58697870-58697892 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
956086154 3:65613109-65613131 CTGTGGAGGTGGTTAGAACTAGG + Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956141278 3:66149104-66149126 CTGTGGACATGGGGATAAGTGGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956848644 3:73207379-73207401 CTGTGGAGATGAAGGGATTTGGG + Intergenic
957451762 3:80389291-80389313 CTGATGAGAAGGAGAAAAATTGG - Intergenic
957596036 3:82268077-82268099 TGGTGGAGAGAGAGAGAAATAGG + Intergenic
957777770 3:84776435-84776457 TTGTGTATATGGTGAGAAATAGG - Intergenic
957955744 3:87184908-87184930 CTGAGGAGAAGAAGAGAAATAGG + Intergenic
958133442 3:89458653-89458675 CAGCGAAGATGCAGAGAAATAGG - Intronic
958267749 3:91459576-91459598 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
958933079 3:100228484-100228506 CTGAGAAGAGGGAGAGAGATGGG - Intergenic
959039113 3:101400662-101400684 CTGAGGAGAGAGAGAGAGATAGG - Intronic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960154618 3:114286185-114286207 TTGAGGAGAGGGAGAGAGATGGG + Intronic
960258867 3:115542033-115542055 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960669001 3:120138943-120138965 CGGAGGAGAGGGAGAGAGATGGG - Intergenic
960691912 3:120355196-120355218 TGGTGCAGATGTAGAGAAATTGG + Intergenic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961536267 3:127572906-127572928 CTGGGGAGGTGAAGAGAAACAGG - Intergenic
962275113 3:134006956-134006978 TTTTGAGGATGGAGAGAAATTGG - Intronic
962412564 3:135154129-135154151 CTGTGGAGAGAGAAAGAAACAGG - Intronic
962454410 3:135551989-135552011 CTGTAGAGATGGACATAAACAGG - Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962932886 3:140053817-140053839 TTGTGGAGATGGAGTGAGATGGG + Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087610 3:141453121-141453143 CAGTGAAGATAGAGAGAAAGGGG + Intergenic
963390822 3:144661631-144661653 CTGTGAGGATGCAGAGCAATTGG - Intergenic
963516132 3:146310860-146310882 TTGTGTAAATGGTGAGAAATAGG + Intergenic
963542759 3:146615187-146615209 CTGAGGATGTGGAGAGAGATGGG - Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963659087 3:148101536-148101558 CTGTAGAGAGGGAGAAAAAGTGG + Intergenic
964019131 3:151985625-151985647 CTGAGGAGAGGGAAAGAGATGGG + Intergenic
964325481 3:155541511-155541533 CTGAGGAGTGGGAGAGAGATGGG + Intronic
964813575 3:160692550-160692572 TTGAGGAGAGGGAGAGAGATGGG - Intergenic
965053915 3:163689552-163689574 ATGTGGGGATTGAGAGAAAGTGG - Intergenic
965224180 3:165966666-165966688 CTGAGGGGAGGGAGAGAGATGGG - Intergenic
965447367 3:168791692-168791714 ATGGGGAGATGAAGAGAAGTTGG + Intergenic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966542846 3:181111031-181111053 CAGTGAAGATCGGGAGAAATGGG - Intergenic
966644727 3:182231669-182231691 CTAGGGAGAGGGAGAGAGATGGG + Intergenic
967201558 3:187076547-187076569 CTGGGGATTTGGAGAGAGATGGG + Exonic
967421539 3:189278510-189278532 CTACAGAGATGGATAGAAATTGG - Intronic
967603646 3:191418099-191418121 CCGAGGTGAGGGAGAGAAATAGG - Intergenic
968903294 4:3440906-3440928 CTGTGCAGAGGGAGAGAGAATGG - Intergenic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969830949 4:9796306-9796328 CTGTGGAGATGGGAATGAATTGG - Intronic
969967713 4:11014195-11014217 CTGTGGAGCTGGCCTGAAATAGG - Intergenic
970007598 4:11426537-11426559 CTGAGAAGCTGGTGAGAAATTGG - Intronic
970528781 4:16960718-16960740 CTAAGGAGAAGGAGAGAAAAGGG - Intergenic
970884630 4:20973779-20973801 CTGTGGAGAGGGTGAGAGACTGG + Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971346819 4:25818995-25819017 CTCTGGAGATAGAGACATATGGG + Intronic
971441266 4:26689768-26689790 CTGAGGAAAGGGAGAGAAATGGG - Intronic
971628295 4:28953433-28953455 CTGTGGAACTGTAGACAAATAGG + Intergenic
972281726 4:37608135-37608157 CTGAGGAGAGGGAGAGAGACGGG - Intronic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
972760640 4:42100141-42100163 AGGAGGAGATGGGGAGAAATTGG - Intergenic
974173109 4:58292610-58292632 CTGATGAGAAGGAGAAAAATTGG + Intergenic
974960800 4:68697744-68697766 CTAAGGAGAGAGAGAGAAATGGG - Intergenic
974973153 4:68855963-68855985 CTGAGGAGACAGAGATAAATGGG - Intergenic
975023818 4:69524398-69524420 CAGAGGAGAGGGAGAGAGATGGG + Intronic
975268845 4:72405046-72405068 TTGAGGAGATGTAGAGAAAAGGG + Intronic
975641737 4:76507377-76507399 TGGTGAAGATGTAGAGAAATTGG - Intronic
976185593 4:82439826-82439848 ATGTGGAGTTTGAGAGAAAGAGG + Intronic
976839748 4:89418326-89418348 CTTAGGAGATGGAGAGGGATGGG - Intergenic
976934611 4:90614263-90614285 CTGAGGACAGGGAGAGATATAGG - Intronic
977046516 4:92074344-92074366 CTGAGGAAATAGAGAGACATTGG + Intergenic
977069749 4:92370301-92370323 CTGAGAAGAGGGAGAGAGATGGG - Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979448831 4:120844618-120844640 CTGAGGAGAGAGAGAGAGATGGG - Intronic
979995156 4:127423551-127423573 TAGTGGAAATGAAGAGAAATAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981200642 4:141975472-141975494 GTGAGGAGAGGGAGAGAGATTGG - Intergenic
981250352 4:142593683-142593705 CTATGGAGAAAGAGAGAAAGTGG - Intronic
981493012 4:145361191-145361213 CTGAGGAGAGGGAGAGAGATAGG - Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981723330 4:147823380-147823402 GTGTGGAAAGGGAGAGAACTTGG + Intronic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982152765 4:152480385-152480407 CTGAGGAGAGGGAGAGAGATAGG - Intronic
982166576 4:152618709-152618731 AAGTGGAGGTGGAGAGAAAGTGG - Exonic
982439102 4:155414044-155414066 CTGAGCAGAGGGAGAGAGATGGG + Intergenic
983044689 4:162972042-162972064 TTTTGGAGATGGAGAGATATGGG - Intergenic
983963243 4:173779395-173779417 CTGAGAAGAGGGAGAGACATGGG - Intergenic
983987405 4:174076269-174076291 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
984376696 4:178939626-178939648 TTATGGAGATGAAGAGAATTGGG + Intergenic
984637137 4:182123518-182123540 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
985042173 4:185902429-185902451 CTGTGCAGTTGGAGAGTAAATGG + Intronic
985185605 4:187311865-187311887 CTGAGGAGCGGGAGAGAGATTGG + Intergenic
985277396 4:188251216-188251238 CTATGGAGAGGAAGGGAAATGGG - Intergenic
985311105 4:188600418-188600440 CTGAGGAGAAGGACAGAGATGGG + Intergenic
986216652 5:5725732-5725754 GTGGGGAGGAGGAGAGAAATGGG + Intergenic
986606942 5:9531975-9531997 CTGTGGACAAAGAGATAAATTGG + Intronic
987088890 5:14493579-14493601 CTGAGGAGAGGGAGACACATGGG - Intronic
987242349 5:16013458-16013480 CTGAGAAGAGGGAGAGAGATGGG + Intergenic
987544435 5:19294633-19294655 GGGTGGAGATGAAGAGAGATTGG - Intergenic
987626226 5:20404535-20404557 CTGATGAGAGGGAGAGAGATAGG + Intronic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987726659 5:21709403-21709425 CTGAGGAGAAGGAAAGAGATGGG - Intergenic
987801395 5:22701329-22701351 CTGTGGAGTTGGAGAACATTAGG - Intronic
987978072 5:25042147-25042169 CTGAGGAAATGGAGAGCAACAGG - Intergenic
988160437 5:27513286-27513308 CTGAGGAGAGGAAGAGAGATGGG - Intergenic
988204074 5:28111572-28111594 CTCTGCAATTGGAGAGAAATGGG + Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
988431609 5:31125540-31125562 CTGAGAAGAGGGAGAGAGATAGG - Intergenic
988655521 5:33207306-33207328 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
988669768 5:33368837-33368859 CTGAGGAGAGGGAGAGAGAAAGG + Intergenic
989532380 5:42523618-42523640 CAGAGGAGAGGGAGAGAGATAGG - Intronic
989654107 5:43725909-43725931 CTGAGGAGAAGGCGAGAGATTGG + Intergenic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990149724 5:52802288-52802310 GTGTGGAGGTGGGGAGAAAAGGG - Exonic
990436432 5:55796535-55796557 CTATGAAGATGGAAAGATATGGG - Intronic
990481580 5:56216316-56216338 CTGAGGAGAGGGAGAGAGATGGG - Intronic
990614939 5:57498247-57498269 ATGGGTGGATGGAGAGAAATAGG - Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990788767 5:59453243-59453265 CTGAGGAGAAAGAGAGAGATAGG - Intronic
990801863 5:59613140-59613162 CCATGGTGATGGTGAGAAATGGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991411347 5:66348468-66348490 ATGTGAAGAAGGAAAGAAATTGG - Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992548405 5:77838023-77838045 AGATGGAGATGGAGAGAAAATGG + Intronic
992922229 5:81537794-81537816 CTGAGGAGAGGGACAGAGATGGG - Intronic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993186491 5:84628808-84628830 ATGTGGAGTGGGAGAGAAAGGGG + Intergenic
993275980 5:85859305-85859327 CTGAGGAGAGGGAGAAAAATGGG + Intergenic
993368758 5:87065449-87065471 CTGAGGAGAGAGAGAGAGATGGG + Intergenic
993400461 5:87443499-87443521 CTGAGAAGAGGGAGAGAGATGGG + Intergenic
993538562 5:89119276-89119298 CTGGGAAGATGAAGAGGAATTGG + Intergenic
993709402 5:91209254-91209276 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
993805719 5:92406656-92406678 CTAAGGAGATGGAGAGAAATGGG - Intergenic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
994909945 5:105890701-105890723 TTGGTGAGATGTAGAGAAATTGG + Intergenic
995134741 5:108668954-108668976 CTGGGGAGATGGAGAAAATATGG - Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
996086916 5:119314684-119314706 CTTTGGAGCCAGAGAGAAATAGG + Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996569459 5:124916667-124916689 CTGGCGAGATGTGGAGAAATAGG + Intergenic
997321171 5:132979913-132979935 TTGTGAAGATGTGGAGAAATTGG + Intergenic
997566649 5:134892814-134892836 CTGAGGAGAGGGAGAGAGATGGG + Intronic
997695080 5:135854986-135855008 CTGAGGAGAGGGAGAGAGATAGG + Intronic
997794074 5:136790312-136790334 CTGTGAAGATTCAGAGAAAGGGG + Intergenic
998566782 5:143223002-143223024 CTTTAGAGATGGTGAGAGATTGG - Exonic
998985587 5:147752710-147752732 ATGGGGAGATGGAGAGATCTAGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999362468 5:150997637-150997659 CTTTGGAAATTGAGGGAAATTGG - Intergenic
999598860 5:153237803-153237825 CTCTGGGGCTGGAGAGAAAGGGG - Intergenic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1000452892 5:161412395-161412417 CAGTGGAGATGGTAAGGAATCGG - Intronic
1000453804 5:161423627-161423649 CTGAGGAGAGAGAGAGAGATAGG - Intronic
1000464746 5:161561983-161562005 CTGTGCAGATGATGAGAAACAGG - Intronic
1001054790 5:168440314-168440336 TGGTGAAGATGTAGAGAAATTGG + Intronic
1001188400 5:169600954-169600976 GTGTGGAGATGAAGAGACAGCGG - Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001822700 5:174722243-174722265 CTGCTGAGGTGGAGACAAATCGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003150490 6:3544008-3544030 CTGAGGAGAAAGAGAGAAAGGGG - Intergenic
1003528251 6:6916494-6916516 CTGTGCTCATGGAGAGAAAATGG + Intergenic
1004152843 6:13136771-13136793 CTGAGGAGAGGGAGAAAGATAGG + Intronic
1004180344 6:13375905-13375927 CTGTAGAGATGGAGATGTATGGG - Intronic
1005472492 6:26175513-26175535 GTGTGTAGATGTAGAGAACTTGG + Intergenic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005633863 6:27734711-27734733 CTGGGGAAGTGAAGAGAAATGGG - Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007550303 6:42724207-42724229 TTGGGGAGATGGAGAATAATGGG - Intergenic
1008309116 6:49943218-49943240 CAGTTGAGATAGACAGAAATGGG + Intergenic
1008344265 6:50407072-50407094 ATGTGGAAAAGGAGAGCAATTGG + Intergenic
1008987465 6:57562008-57562030 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009175420 6:60454565-60454587 CTGAGGAGAGGGAGAGAGACAGG + Intergenic
1009181852 6:60527264-60527286 ATGTGGAAATCCAGAGAAATGGG - Intergenic
1009600914 6:65797973-65797995 GTGTGGGGATGGAGCAAAATTGG + Intergenic
1009700443 6:67171053-67171075 CTTTGTATATGGTGAGAAATAGG - Intergenic
1009749944 6:67869947-67869969 CTGATGAGAAGGAGAGAAATTGG + Intergenic
1009973021 6:70644859-70644881 CTATGGAGATGGAGAAAGAGGGG + Intergenic
1010016585 6:71111174-71111196 TATTGGAGATGGAGAGAAAATGG - Intergenic
1010050055 6:71493083-71493105 CTGAGGAGAGGCAGAGAGATGGG - Intergenic
1010538807 6:77064916-77064938 TGGTGGAGATGAAGAGAAACTGG - Intergenic
1010652858 6:78475678-78475700 ATGCAGAGATGGAGAAAAATAGG + Intergenic
1010867407 6:80996069-80996091 CTGGTGAGATGTAGAGAAAAGGG - Intergenic
1010881861 6:81185825-81185847 CTTGGGAAATGGAGAGAATTTGG + Intergenic
1010921887 6:81692345-81692367 GTGTTGAGATGGGGAGAAAGGGG - Intronic
1011200705 6:84832658-84832680 CTGTGGAGATTTAGAAACATGGG + Intergenic
1011218030 6:85026092-85026114 CTGAAGAGAGGGAGAGAGATGGG - Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1012084152 6:94802108-94802130 CTGAGGAGAGGTAGAGAGATGGG - Intergenic
1012284463 6:97372169-97372191 CTGAAGAGAAGGAGAGAGATGGG - Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1012564889 6:100636428-100636450 CTGAGGAGAAGGAAAGAGATGGG - Intronic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013668193 6:112369600-112369622 CTGTGGAGGGGAAGAGAAATTGG + Intergenic
1013796108 6:113890962-113890984 TTGAGGAGAGGGAGAAAAATGGG - Intergenic
1014138802 6:117917823-117917845 ATGTGTAGATAGAGAGAAAGAGG + Intronic
1014319604 6:119910542-119910564 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1014337658 6:120157638-120157660 CTAAAGAGAGGGAGAGAAATGGG + Intergenic
1014408663 6:121085985-121086007 CTCAGGAGCTGGAGAAAAATGGG + Intronic
1014618031 6:123628324-123628346 CTGAGGAGAAGGAGAGATAGTGG + Intronic
1015648290 6:135421043-135421065 CTGAAGAGAGGGAGAGAAATGGG + Intronic
1015797061 6:137023607-137023629 CTGTGGAGAGGGAGATGCATGGG + Intronic
1015857832 6:137644569-137644591 GGGGGGAGATGAAGAGAAATGGG - Intergenic
1015980866 6:138837181-138837203 ATATGCAGTTGGAGAGAAATTGG - Intronic
1016235699 6:141862827-141862849 CGCTGCAGATTGAGAGAAATGGG + Intergenic
1016344176 6:143093794-143093816 CTGAAGAGAAGGAGAAAAATGGG + Intronic
1016418454 6:143858223-143858245 CTGTGCAGAAGAAGAGTAATTGG + Intronic
1016473844 6:144404721-144404743 TTATGAAAATGGAGAGAAATAGG + Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016616939 6:146061058-146061080 CTGTGGAGAGGGAGAGAGATGGG + Intronic
1016634462 6:146271468-146271490 CTGTGGAAAAGGAGACAAAGGGG + Intronic
1017242107 6:152181906-152181928 TGGTGAAGATGTAGAGAAATTGG - Intronic
1017243727 6:152198687-152198709 CAGAGGAGAAGGAGAGAGATTGG + Intronic
1017553929 6:155542624-155542646 TTGTGGGGATGAAGAGGAATTGG + Intergenic
1017660495 6:156669646-156669668 CTGTGGAGAGGGAGAGGGAGAGG - Intergenic
1017734674 6:157350484-157350506 CTGAGGAGAGGGAGAGATATAGG - Intergenic
1018818264 6:167351976-167351998 CTGAGGGGAGGGAGAGAGATGGG - Intronic
1019590916 7:1831392-1831414 CTAAGGAGAAGGAGAGAGATGGG - Intronic
1019755532 7:2766116-2766138 CTGGGCAGATGGGGGGAAATGGG - Intronic
1020127454 7:5541028-5541050 GGGTGGAGAAGGAGAGAAAAGGG + Intronic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1020626183 7:10582432-10582454 CTGAGTAGAGGGAGAGAGATGGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021333099 7:19363589-19363611 CTGGGGAAATGTAGATAAATTGG - Intergenic
1021376569 7:19915143-19915165 CTGAGGAGCAGGAGAGAAATGGG + Intergenic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022294917 7:29041568-29041590 ATGTGGAGAAAGAAAGAAATTGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022594545 7:31699954-31699976 CAGGGGAGAGGGAGAGAGATAGG - Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022762408 7:33369662-33369684 CTATGGTGATGGAGAGAGATAGG + Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1023773250 7:43579289-43579311 CTGAGGAGAGGAAGAGAAATGGG + Intergenic
1023777013 7:43617394-43617416 TTCCGTAGATGGAGAGAAATAGG + Intronic
1024280933 7:47719167-47719189 CTTTGGAGTTGGAGAGAATGTGG + Intronic
1024316544 7:48024514-48024536 TAGTGGAAATGTAGAGAAATTGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026339615 7:69424149-69424171 CTGGGGTGCTGGGGAGAAATGGG + Intergenic
1026567240 7:71499676-71499698 CTGTATAGATGAAGAGAAATCGG - Intronic
1027230884 7:76271713-76271735 CTGTGGAGAGGGTGGAAAATGGG + Intronic
1027253069 7:76411173-76411195 ATGTGCAGATGGAGGGAAAGAGG - Intronic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027621175 7:80487361-80487383 CTGTGGAGAAAGCTAGAAATGGG + Intronic
1027932839 7:84561475-84561497 CTGGGGAGATAGAGTGACATGGG + Intergenic
1028101785 7:86829605-86829627 CTGAGGTGATGGAGAGAGATAGG + Intronic
1028178309 7:87683541-87683563 CTGAGGAGAAAGAGAGAGATGGG + Intronic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028271720 7:88799461-88799483 CTATGGTCATGGATAGAAATAGG - Intronic
1028768606 7:94589341-94589363 CAATGGAGATGGGGAGGAATGGG - Intronic
1028795148 7:94894117-94894139 GTGTGGACATAGAAAGAAATGGG - Intergenic
1030132986 7:106218911-106218933 CTTTGTGGATGGAGAGGAATGGG + Intergenic
1030704561 7:112678091-112678113 AGATGGAGATGGAGAGAACTGGG + Intergenic
1030939428 7:115627984-115628006 CTTTGAAGATGGAGAAAAAGGGG + Intergenic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1031413559 7:121468299-121468321 ATTTGGAAATGGAGAGAAAGTGG + Intergenic
1031586077 7:123533766-123533788 GCCTGGAGATGGGGAGAAATGGG + Intronic
1031815286 7:126426156-126426178 CTGAGGAAAGGGAGAGAAATGGG + Intergenic
1031894609 7:127334813-127334835 TTGTGAAGATGCAGAGAAAGAGG + Intergenic
1033584231 7:142762405-142762427 CTGTGGAGATTGTGGGAAAGAGG + Intronic
1033649443 7:143329660-143329682 CTGTTCACATGGAGAGAAAGGGG + Intronic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1034111745 7:148544029-148544051 GTGTGGAGATGGGAAGAGATGGG + Intergenic
1034380097 7:150684456-150684478 CTGTTGAGATGAAGATAAAATGG - Intergenic
1034690353 7:153008699-153008721 CTGGGAAAAAGGAGAGAAATGGG + Intergenic
1035006099 7:155662330-155662352 CTGCTGTGCTGGAGAGAAATGGG - Intronic
1035173465 7:157033753-157033775 CCGTGCAGATGGACAGAAAGGGG - Intergenic
1035823935 8:2624263-2624285 TTGTGGAGATGTGGAGAAAAGGG + Intergenic
1036108074 8:5863666-5863688 CTGAGGAGATGGAGAGAGACAGG + Intergenic
1036478188 8:9113395-9113417 CTGAGGAGAGGGAGGGAGATTGG + Intronic
1036485211 8:9173202-9173224 CAGTTGAGATGGAAAGAAAGTGG - Intergenic
1036690426 8:10941399-10941421 CTGTGGAGATGGAGAAACTGAGG + Intronic
1036787333 8:11696990-11697012 CCGGGGAGATGGTGTGAAATAGG + Intronic
1037272045 8:17141088-17141110 CTGTGGAGCTGGAGCAGAATGGG + Intergenic
1037456185 8:19066566-19066588 CTGTGGAGTAGAAGAGAAGTTGG - Intronic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1038556805 8:28525759-28525781 GTGTGGAAATGGAGATCAATTGG + Intronic
1038873782 8:31525384-31525406 GTGAGGAGATGGAGAGGAAGTGG - Intergenic
1039200696 8:35090190-35090212 CTGTGTCAATGAAGAGAAATAGG + Intergenic
1039254791 8:35707160-35707182 CTGTGAGGATAGACAGAAATAGG + Intronic
1039652632 8:39358715-39358737 CTGTGGAGAGGGAAAGACAGGGG - Intergenic
1039701760 8:39969448-39969470 CTGAGGAGGGGGAGAGAGATGGG - Intronic
1040036788 8:42878116-42878138 CTGAGGAGAGGGAGAGAGACTGG - Intronic
1040061382 8:43106127-43106149 TGGTGAAGATGCAGAGAAATGGG - Intronic
1040551181 8:48438846-48438868 CTGTGGACATGGAAAGAGCTGGG + Intergenic
1040732407 8:50464483-50464505 CTGCAGAGAGGGAGAGAAATGGG + Intronic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041540347 8:58977720-58977742 CTGAGGAGAGGGGGAAAAATAGG + Intronic
1041651498 8:60307568-60307590 CTGATGAGAAGGAGAAAAATTGG + Intergenic
1042408099 8:68429399-68429421 TGGTGAAGATGTAGAGAAATGGG + Intronic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1043136302 8:76530271-76530293 CTGTTGGGAGGGAAAGAAATGGG - Intergenic
1043642807 8:82477865-82477887 ATGAGGAGTTGGGGAGAAATTGG + Intergenic
1043689553 8:83133026-83133048 CTGATGAGATGTAGAGAAATGGG + Intergenic
1043774420 8:84246780-84246802 ATGTGGAGGAGGAGAGACATGGG + Intronic
1043977823 8:86602925-86602947 CTGGGGAGATGAAGCCAAATAGG - Intronic
1044030890 8:87235507-87235529 CTGAGGACAGGGAGAGAGATGGG + Intronic
1044044103 8:87408927-87408949 CTGAGGAGAGAGAGAGAGATGGG - Intronic
1044089787 8:87984986-87985008 CTGAGGAGACAGAGAGAGATGGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044133409 8:88555508-88555530 TGGTGAAGATGTAGAGAAATTGG - Intergenic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046147053 8:110174015-110174037 AGGTGGAGAGGGGGAGAAATGGG + Intergenic
1046424025 8:114022741-114022763 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
1047009897 8:120660882-120660904 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047141761 8:122148714-122148736 CTGAGAAGCTGAAGAGAAATAGG + Intergenic
1047221794 8:122924581-122924603 CTGTGGAGATCAAGAGAGACTGG - Intronic
1047227681 8:122970538-122970560 CTGTGGAGTTGGAGAAAGCTGGG - Intronic
1047549712 8:125857151-125857173 CTGTGGTGTTGGACTGAAATTGG - Intergenic
1047703625 8:127474902-127474924 CAGAGGAGATGGGGAGAGATGGG - Intergenic
1047880212 8:129184584-129184606 TGGTGAAGATGTAGAGAAATTGG + Intergenic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048020990 8:130538838-130538860 CTGAGGATGTAGAGAGAAATTGG + Intergenic
1048048344 8:130794061-130794083 ATGTGAGGATGGAAAGAAATTGG + Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048204437 8:132404019-132404041 CTGTGGAGATGTACAGAATGGGG - Intronic
1048902468 8:139051947-139051969 CCAAGGAGATGGAGAGAGATGGG - Intergenic
1048969142 8:139634645-139634667 CTGGGGACCTGGAGACAAATTGG - Intronic
1049046242 8:140154294-140154316 ATGTGGAGCCAGAGAGAAATGGG - Intronic
1049299037 8:141860088-141860110 ATGCGGAGATGGAGAGAGGTGGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049853472 8:144847177-144847199 TTGTGGAGAGGGAGAGGAAGAGG + Intronic
1050520232 9:6489548-6489570 CTGGTGAGATGCAGAGAAACTGG - Intronic
1050527486 9:6558589-6558611 CTGTGGAGGTGGATAAATATGGG - Exonic
1050792584 9:9493010-9493032 CTGAGGAGAGGGAGAGTGATGGG - Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051123750 9:13780383-13780405 CTGAGGAGAGGGAGAGACATGGG - Intergenic
1051156480 9:14152879-14152901 GTGAGGAGATGAAGAGAGATTGG + Intronic
1051417638 9:16859209-16859231 CTGTGAGGTTGTAGAGAAATTGG + Intronic
1051437690 9:17050579-17050601 CTCTGGAGAAGGAGGAAAATAGG - Intergenic
1051694644 9:19754803-19754825 CTGTCGAGCAGGAGAGGAATCGG - Intronic
1051721617 9:20042968-20042990 CCAAGGAGAAGGAGAGAAATGGG - Intergenic
1051851851 9:21518655-21518677 GTGTGGAAATGTAGAGAATTTGG + Intergenic
1052050876 9:23848914-23848936 CTGTTGCCATGGAGAGAACTGGG - Intergenic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1052667884 9:31518499-31518521 CCGTGAAGATGGGGAGAAACAGG - Intergenic
1053535025 9:38916842-38916864 CTGTACTGAAGGAGAGAAATAGG + Intergenic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054207244 9:62141264-62141286 CTGTACTGAAGGAGAGAAATAGG + Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054631107 9:67447090-67447112 CTGTACTGAAGGAGAGAAATAGG - Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054839411 9:69719969-69719991 CTGGGGTGAGGGAGAGAGATGGG - Intronic
1054931386 9:70639080-70639102 GTCTGGAGATGGTGAGAAAACGG + Exonic
1055150679 9:72995260-72995282 TTGAGGAGAAGGAGAGAGATGGG - Intronic
1055347335 9:75352697-75352719 CTTTGGAGATGAAGAGTAAAGGG + Intergenic
1055984460 9:82042370-82042392 TTGGGGAAATAGAGAGAAATTGG - Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056959622 9:91111583-91111605 CTGAGGAGAAGGAAAGAGATGGG + Intergenic
1057010358 9:91595971-91595993 GTGGGGAGATGGAGAGAATCAGG - Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058211509 9:102175098-102175120 CTTTGGATATGGTGAGAAATAGG + Intergenic
1058266482 9:102905238-102905260 CGGTGAGGATGCAGAGAAATAGG + Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059819925 9:117960971-117960993 TTGAGGAAATGGAGAGAAAATGG - Intergenic
1059833647 9:118126659-118126681 CTGAGGAGAGGGAGAGACATGGG - Intergenic
1060041363 9:120304352-120304374 CCGTGGAGATGGAGAGGGAGAGG - Intergenic
1060092373 9:120754602-120754624 CTTTGGAGAGGTAGAGAAAAGGG - Intronic
1060165975 9:121415720-121415742 CTGGGAAGATGTGGAGAAATAGG - Intergenic
1060207095 9:121688537-121688559 CTCTGGAGACAGAGAGAGATGGG - Intronic
1060654376 9:125358978-125359000 CTTTGTAGATGAAGAGAAGTAGG - Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061099401 9:128481023-128481045 CTCTGTAGATGTAGAGAAAAAGG + Intronic
1061221427 9:129254217-129254239 CCTTGGAGAGGGAGAGAGATAGG + Intergenic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1185844839 X:3428045-3428067 CTCAGGAGATGGAAGGAAATTGG + Intergenic
1185922675 X:4111707-4111729 ATGTGGAAATGAAGACAAATGGG + Intergenic
1186659907 X:11659345-11659367 CTGTAGAGAGTGGGAGAAATTGG - Intronic
1186680904 X:11872890-11872912 CTGTGAGGATGTGGAGAAATTGG + Intergenic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1186693002 X:11999219-11999241 CTGTGGACATGGATAGAAACAGG - Intergenic
1186914811 X:14207955-14207977 CTGTGTAGAGGGGGAGAGATGGG + Intergenic
1186969867 X:14830093-14830115 CTGATGAGAGGGAGAGAAACAGG + Intergenic
1187119467 X:16390217-16390239 TTGTGAGGATGCAGAGAAATTGG + Intergenic
1187311024 X:18142878-18142900 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1187872618 X:23777094-23777116 TGGTGTAGATGTAGAGAAATTGG + Intergenic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1188657129 X:32711683-32711705 CTGTGGTGCTGTAGAGATATGGG - Intronic
1188732646 X:33670201-33670223 CTGAAGAGAGGGAGAGAGATGGG - Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190414609 X:50168457-50168479 CGGTGAAGATGTGGAGAAATGGG + Intergenic
1190467139 X:50736390-50736412 CTGGGGAGATGGAGAGCGTTAGG - Intronic
1190473629 X:50807227-50807249 GTGGGGAGATGGGGAGAAAGAGG + Intronic
1190964288 X:55283094-55283116 TTCTAGAGATGGAGAAAAATTGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191186536 X:57619216-57619238 CGGTGAAGTTGGGGAGAAATAGG + Intergenic
1191218694 X:57961843-57961865 TTGTGAGGATGGGGAGAAATTGG - Intergenic
1191219506 X:57972724-57972746 TTGTTGATATGGAGAGAAATGGG + Intergenic
1191878465 X:65820790-65820812 ATGTGGGGAGGGAGAAAAATTGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192348593 X:70334901-70334923 ATGTGAAGATATAGAGAAATTGG + Intronic
1192403135 X:70857156-70857178 CTGAGGAGATGGATAAAGATGGG + Intronic
1193569029 X:83118724-83118746 CTGAGGAAAGGGAGAGATATGGG + Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193860550 X:86661325-86661347 CTTTGCGGATGCAGAGAAATGGG - Intronic
1193867268 X:86749466-86749488 CTGAGCAGAGGAAGAGAAATGGG + Intronic
1193951572 X:87807302-87807324 TAATGGAGATGGAGAGTAATAGG - Intergenic
1194213700 X:91101060-91101082 ATGTGGAGATGGAGAACATTTGG - Intergenic
1194591230 X:95802374-95802396 CTAAGGAGAGGGAGAGAGATGGG - Intergenic
1194763973 X:97827637-97827659 TTGTGAAGATGGAAAGACATAGG + Intergenic
1195003091 X:100661126-100661148 TTGTGAAGATGGAGAGAAACTGG - Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195283167 X:103356933-103356955 CTGTGGAGAGGGGGTGAACTAGG + Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1196063906 X:111441804-111441826 CTCTGGAAAGGGAGAGAAATGGG + Intergenic
1196067320 X:111478420-111478442 CTGAAGAGAGGGAGAGAGATGGG + Intergenic
1196194238 X:112823146-112823168 TTGTGAAGAGAGAGAGAAATTGG + Intronic
1196370740 X:114977063-114977085 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1197443757 X:126523315-126523337 ATGAGGAGACAGAGAGAAATAGG - Intergenic
1197462339 X:126757761-126757783 CTGTGGAGATGCATAGATATTGG + Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1198323142 X:135539794-135539816 CTGAGGAGAGGGAGAGAGATAGG + Intronic
1198490593 X:137136394-137136416 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1198542899 X:137659158-137659180 CTGAGGAGATGGATAGAGAGGGG - Intergenic
1198892316 X:141411548-141411570 CTAAGGAAATGGACAGAAATAGG + Intergenic
1199075834 X:143524570-143524592 TTATGTATATGGAGAGAAATAGG + Intergenic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199103021 X:143827994-143828016 CTGAGGAGATGAAGAGAGATAGG - Intergenic
1199200630 X:145084776-145084798 TTGAGCAGATGTAGAGAAATTGG - Intergenic
1199577599 X:149328401-149328423 CTGAGTAGAAGGAGAGAGATGGG - Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1200077248 X:153557259-153557281 CTGTGGAGAGGAAGGGGAATGGG + Intronic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1201574547 Y:15448294-15448316 CTGAGGAGAGGCAGAGATATGGG - Intergenic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic