ID: 1022923511

View in Genome Browser
Species Human (GRCh38)
Location 7:35038004-35038026
Sequence CGGGGCAGGGAGAAGGCGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 508}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022923503_1022923511 -3 Left 1022923503 7:35037984-35038006 CCCGCGCAGGCGAGACGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 96
Right 1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG 0: 1
1: 0
2: 2
3: 47
4: 508
1022923500_1022923511 19 Left 1022923500 7:35037962-35037984 CCTGTTAAGGCTGCGCTTGGAGC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG 0: 1
1: 0
2: 2
3: 47
4: 508
1022923505_1022923511 -4 Left 1022923505 7:35037985-35038007 CCGCGCAGGCGAGACGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG 0: 1
1: 0
2: 2
3: 47
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022923511 Original CRISPR CGGGGCAGGGAGAAGGCGCC CGG Exonic
900102478 1:967748-967770 GTGGGCAGGGAGAGGGAGCCGGG + Intronic
900135447 1:1115489-1115511 CGGGGCAGGGAGGGGGTCCCTGG - Intronic
900189688 1:1348158-1348180 TGGGACAGGGAGCAGGAGCCTGG - Intronic
900342637 1:2195956-2195978 CCGGGCAGGGGGAGGGGGCCTGG + Intronic
900425452 1:2576324-2576346 CAGGGCAGAGAGAGGGCGCTTGG + Intergenic
900546723 1:3233553-3233575 AGGGGCAGGGAGAAGGATGCTGG - Intronic
900586977 1:3437296-3437318 CGGGGAAGGCAGAGGACGCCAGG - Exonic
900626698 1:3611699-3611721 CGGGGCTGGAAGCAGGAGCCGGG - Intergenic
900993751 1:6109426-6109448 GGGGCCAAGGAGAAGGCTCCAGG + Intronic
901631796 1:10651609-10651631 CGGGGCAGGGACACGAGGCCAGG + Intronic
901641612 1:10695555-10695577 CGGGGAGGGGAGGAGGAGCCGGG - Intronic
901651722 1:10746920-10746942 AGGGGCAGGGAGTGGGAGCCTGG - Intronic
901813172 1:11779128-11779150 GGTGGAAGGGAGAAGGGGCCGGG - Intronic
901839441 1:11944775-11944797 CGGGGCAGGGAGCTGGCCCCAGG - Intronic
902258620 1:15207163-15207185 CGGTGCAGGGAGAATGCTCAAGG + Intronic
902440245 1:16424844-16424866 GGGGGGAGGGAGGAGGTGCCAGG - Intronic
902671281 1:17975868-17975890 AGGGGCAGGGAGAAGACCACTGG - Intergenic
902720658 1:18302056-18302078 GGAGGCAGTGAGAAGGTGCCAGG - Intronic
902768619 1:18632761-18632783 TTGGGCAGCGAGACGGCGCCGGG + Intronic
902798689 1:18815995-18816017 AGGAGCAGGGCGAAGGCACCAGG - Intergenic
903142956 1:21350683-21350705 CAGGGCAGGGGGAAGGGTCCTGG - Intergenic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903349569 1:22710103-22710125 CGGGGCAGGGAGGGGAGGCCTGG + Intergenic
903603065 1:24556162-24556184 CAGAGCAGGTAGGAGGCGCCTGG + Exonic
903773378 1:25778064-25778086 TTGGGCAGGGAGAAGGGGCGTGG - Intronic
904402717 1:30267251-30267273 CGGGGCAGGGAGTGGGGGCGGGG + Intergenic
904600238 1:31668909-31668931 TGGGGCAGGGGGAAGGAGTCAGG - Intronic
904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG + Exonic
904768965 1:32870619-32870641 CGGGGCGGGGGGCCGGCGCCGGG - Intronic
905275504 1:36815318-36815340 CGGGGAGGGGAGAAAGTGCCAGG + Intronic
905448928 1:38045111-38045133 GGGGGCAGAGAGCAGGCGGCGGG + Exonic
905554708 1:38873130-38873152 CCGAGCAGGAAGAAGGCGCTGGG + Intronic
905625985 1:39491143-39491165 GGGGCCACGGGGAAGGCGCCAGG + Intergenic
905933813 1:41807885-41807907 GGGGGCAGGGGGAAGGCATCAGG + Intronic
907069287 1:51519282-51519304 CGGGGCGGGGAGGAGGCGGAGGG + Exonic
907074205 1:51564146-51564168 GGGGGCAGAGGGAAGGAGCCAGG - Intergenic
907909596 1:58814779-58814801 CGGGGCCCGGAGGAGGCGCAGGG - Intergenic
908096723 1:60746862-60746884 CGGGGCAGGGGGATGGTGTCAGG + Intergenic
908128299 1:61050971-61050993 GGGGGCAGGGAGGGGGCGTCCGG + Intronic
909443590 1:75724400-75724422 CGGGGGAGGGGGACGGCGGCGGG - Intronic
909893307 1:81035284-81035306 GGGGGCAGGGAGAAGGAGAGTGG + Intergenic
910288922 1:85581361-85581383 CGGGGCAGGTGGAGAGCGCCTGG - Exonic
911460489 1:98182923-98182945 CGGGGCAGGGAGAGGTCTTCCGG + Intergenic
915586966 1:156849166-156849188 CGGGGGAGGGAGAAAGCTCGAGG - Intronic
916961440 1:169893704-169893726 CCGGGCGGGGAGGAGGCGGCGGG - Intronic
917175199 1:172226532-172226554 GGTGGCAGGGAGCAGGCTCCAGG - Intronic
918349191 1:183635954-183635976 CGGGGCTGGGCGAAGGAGGCGGG + Intergenic
919748925 1:201024659-201024681 GGGGGCAGGGAAGAGGCGTCTGG - Intergenic
919932304 1:202229296-202229318 TGGGGCAGGGAGAAGGAGAAGGG - Intronic
920051239 1:203166248-203166270 CTGGGCTGGGAGAAGGTGCTTGG + Exonic
920260458 1:204685012-204685034 GCGGCCAGGGAGAGGGCGCCTGG - Intronic
920312095 1:205054511-205054533 CGGAGCAGAGGGGAGGCGCCTGG + Intronic
920546199 1:206820797-206820819 CGGGGTGGGGAGGAGGCGGCAGG - Intronic
921177707 1:212608517-212608539 CGAGGCTGGGGGAACGCGCCTGG + Intronic
921207116 1:212858419-212858441 CGGGGGAGCGAGGTGGCGCCGGG + Exonic
921472616 1:215567403-215567425 CGGAGCACGGAGAAGAGGCCCGG + Exonic
922730474 1:227946726-227946748 CCGGGCAGGGAGAGGCCGCCTGG - Intronic
922822703 1:228494998-228495020 CAGGGCAGGGGGAAGAGGCCAGG - Exonic
922866286 1:228863944-228863966 CAGCGCAGGGAGCAGGCTCCTGG - Intergenic
923394227 1:233544666-233544688 CGGCACAGGGAGAAGGAACCAGG - Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
923712140 1:236395903-236395925 ATGGGCAGGGGGAAGGCGCGCGG - Intronic
924309196 1:242722396-242722418 CGGGGCAGGGGGCAGGGGCAGGG - Intergenic
924436717 1:244049025-244049047 CGGGGCGCGGAGGGGGCGCCAGG - Intronic
924784900 1:247185442-247185464 CGGGGCAGGGGTCAGGCGTCAGG + Intergenic
1062889641 10:1048778-1048800 CGGGGCGGGGAGGAGGCCCGAGG - Intronic
1063190872 10:3693545-3693567 CGGGGAAGGGAGCACGTGCCAGG - Intergenic
1063636603 10:7788320-7788342 CGGGGCAGGGAGGAGGAGATGGG + Intronic
1064075956 10:12269019-12269041 CTGGGCAGGGTGAAGGCACACGG - Intergenic
1064981907 10:21173953-21173975 CCGGGTAGGGAGTCGGCGCCGGG + Intronic
1065588169 10:27240599-27240621 CGGGGGAGGAGGAAGGAGCCGGG - Intronic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067414632 10:46094154-46094176 CGGGGCAGGGAGAGTGAGCCAGG + Intergenic
1067834947 10:49632730-49632752 GGGGGCAGGGTGAAGGCTCAAGG - Intronic
1069594373 10:69661130-69661152 CGGGGGAGGGAGAATGAGCTGGG + Intergenic
1069773928 10:70916009-70916031 CGGGTCAGGGAGAGGGAGGCTGG + Intergenic
1069875619 10:71561298-71561320 GGGGGCAGGGAGGAGGGGCAAGG - Intronic
1070510323 10:77155043-77155065 TGAGGCAGGGAGAAGAAGCCTGG + Intronic
1070835735 10:79445793-79445815 CGGGGCAGGGAGTGGGCGGCGGG - Intergenic
1070961458 10:80502856-80502878 CAGGGCAGGGTGAAGGAGCTAGG + Intronic
1070990632 10:80729152-80729174 CGGGGCAGGGGAAAAGCGCATGG + Intergenic
1071643867 10:87342383-87342405 CGGGGCGGGGCGAAGGAGGCCGG + Intergenic
1072661446 10:97366191-97366213 CGGGGCAGGAAGAAGGACCACGG - Exonic
1072710803 10:97714497-97714519 GAGGGCAGGGAGAGGGTGCCAGG - Exonic
1072757594 10:98030949-98030971 CGAGGAGGGGAGAGGGCGCCTGG + Intergenic
1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG + Intronic
1073290330 10:102410280-102410302 CGGGCCATGGAGCTGGCGCCTGG + Intronic
1073486119 10:103820253-103820275 AGGGGCAGGGAGAAGCAGCTTGG - Intronic
1074923752 10:118046625-118046647 CGGGGTCGGGAGGAGGAGCCGGG - Intergenic
1075532553 10:123242010-123242032 CAGGGCAGGAAGGAGGTGCCAGG - Intergenic
1075683685 10:124349637-124349659 CAGGGCAGGGTGGAGGCCCCAGG + Intergenic
1076546887 10:131251308-131251330 CTGGGCTGGGAGGAGGGGCCGGG - Intronic
1076562086 10:131373648-131373670 TGGGGCAGGGAGAGTGCTCCTGG - Intergenic
1076691335 10:132225177-132225199 GGGGGCAGAGAGCAGGGGCCTGG + Intronic
1076699180 10:132261238-132261260 CGGGGAAGGAATGAGGCGCCTGG + Intronic
1076790603 10:132775013-132775035 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790646 10:132775113-132775135 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076793530 10:132788378-132788400 CGGGGCCCGGAGTGGGCGCCGGG - Intergenic
1077048589 11:556681-556703 CGGGGCAGGGAGCAGGGCCAGGG + Intronic
1077070076 11:665741-665763 CGTAGCAGGGAGATGGAGCCAGG + Intronic
1077102096 11:827008-827030 CGGAGCAGGGACAAGGCTGCGGG - Intronic
1077143446 11:1034840-1034862 TGGGGCAGGGCGAGGGCGGCGGG - Intronic
1077249708 11:1555586-1555608 GGGGTCAGGCAGGAGGCGCCTGG - Exonic
1077319868 11:1936365-1936387 GGGGGCAGGAGGAAGGCTCCAGG - Intronic
1077352476 11:2099336-2099358 GGGGGCAGGCAGCAGGCACCAGG - Intergenic
1077408532 11:2393128-2393150 CTGGGCAGGGACAATGGGCCTGG + Intronic
1077495268 11:2884191-2884213 GGGGGCCGGGAGAGGGCGCGGGG + Intronic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1081492562 11:43579520-43579542 AGGAGCAGGGAGTCGGCGCCCGG + Intronic
1081672853 11:44951071-44951093 CGCGCCCGAGAGAAGGCGCCGGG + Intronic
1081967179 11:47177074-47177096 CGGGGCGGGGCGACGGCGCGCGG + Exonic
1083605298 11:63975041-63975063 CGGCGCAGCGAGGAGGCGACAGG - Intronic
1083656172 11:64230756-64230778 GGGGGCAGAGGGAAGGGGCCTGG - Exonic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083935357 11:65867140-65867162 CGGGGCAGGGAGGTGACGCTGGG - Intronic
1084031065 11:66480732-66480754 CGTGGCGGGGAGAATGCCCCGGG + Intronic
1084086711 11:66858300-66858322 CCGAGCTGGGCGAAGGCGCCTGG - Exonic
1084166112 11:67375461-67375483 GGGGGCAGGGAGGAGGTGCGGGG - Intronic
1084446287 11:69205467-69205489 CTGCGCAGGGAGAAGGACCCCGG + Intergenic
1084658682 11:70534568-70534590 CAGGGCTGGGACAAGGCCCCAGG + Intronic
1084756498 11:71242218-71242240 AGGGGCTGGGAGAAGGGGGCTGG + Intronic
1084892199 11:72242101-72242123 TGGGACATGGAGAAGGTGCCTGG - Intronic
1085120045 11:73961606-73961628 GGAGGCAGGAAGAAGGCGGCAGG - Intronic
1087586158 11:100124493-100124515 AGAGGCAGGGAGAAGCCACCAGG + Intronic
1088461996 11:110092653-110092675 CGGGGCAGGGAATAGGCGCGAGG + Intergenic
1089563296 11:119356803-119356825 CGGGGAAGGGAGAAGGGACGTGG + Exonic
1089687708 11:120167529-120167551 CGGGGCAGAGGGAAGCCTCCGGG + Intronic
1090807903 11:130213836-130213858 CTGGGGAGGGAGACGGCGTCTGG - Intergenic
1090880504 11:130828148-130828170 CGGGGCTGGCAGAAGCCCCCAGG - Intergenic
1091218745 11:133918666-133918688 CGGGGCAGGGGGAGGGCGCTGGG + Intronic
1091549975 12:1530073-1530095 CGGCGCCGGGAGAAGGGGGCCGG + Intronic
1091567884 12:1661849-1661871 CGGGGCAGGGAGGAGGCGGGAGG + Intergenic
1091795282 12:3294480-3294502 CTGGGCAGGGAGGGGACGCCTGG - Intergenic
1091829495 12:3539675-3539697 CGGAGCAGGGAGAAGGAGATGGG - Intronic
1091887237 12:4025631-4025653 GGGGCCAGGGAGAGGGCCCCAGG + Intergenic
1093257377 12:16886700-16886722 GGGAGCAGGTAGAAGGAGCCAGG - Intergenic
1096105574 12:48995465-48995487 CGGGGCCGGGAGCAGGCCTCCGG - Exonic
1096183298 12:49563069-49563091 CGGGCCAGGTAGAAGGCATCAGG + Exonic
1096309193 12:50505249-50505271 CGGGCCGGGGAGAGGGCGCCCGG + Intronic
1096477841 12:51919267-51919289 GGGGGCAGGGAGCATGGGCCAGG - Intronic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1097235477 12:57536437-57536459 AGGGACAGGGAGAAGGGGCAAGG + Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1103488202 12:121296760-121296782 CGGGGGCGGGAGGAGCCGCCCGG + Intronic
1103698660 12:122835970-122835992 CGGGGGACGGAGATGGGGCCGGG + Intronic
1103885088 12:124194478-124194500 TGGGGCAGGGAGAAAGCAACTGG - Intronic
1104813574 12:131633335-131633357 TGGGGGAGGCAGAAGGTGCCTGG + Intergenic
1104891796 12:132143816-132143838 GGGAGCAGCGAGGAGGCGCCGGG - Exonic
1104891807 12:132143852-132143874 GGGAGCAGCGAGGAGGCGCCAGG - Exonic
1104921277 12:132291993-132292015 CGGGGCAGGAAGCAGGAGCGTGG - Intronic
1105462716 13:20607185-20607207 CGGTGCAGGGGGCAAGCGCCAGG - Intronic
1105659920 13:22482898-22482920 CGGGGCCGGATGAAGGCTCCAGG - Intergenic
1105830703 13:24161112-24161134 CCGGGCAGGGAGCGGGCGCACGG - Intronic
1106226627 13:27791409-27791431 CGCGGCAGGAAGAAGAAGCCGGG + Intergenic
1106248053 13:27965350-27965372 GGGGGCAGGGTGAAGTGGCCGGG + Intronic
1106340155 13:28819932-28819954 GCGGGCCGGGAGGAGGCGCCTGG + Intergenic
1106512141 13:30421607-30421629 CGGGGAAGAGCGAAGGCTCCGGG + Intergenic
1108594261 13:51936441-51936463 GGGGGCAGGGAGCAGGGGGCGGG + Intronic
1110318571 13:74135476-74135498 CGGGAGAGGGAGGAGGCGGCCGG + Intergenic
1110630218 13:77698280-77698302 CTAGGCAGGCAGAAGGTGCCCGG - Intronic
1113117064 13:106885234-106885256 CTGGGCAGGGATGAGGCACCAGG + Intergenic
1113201056 13:107867576-107867598 GGGAGGAGGGAGAAGGCGCGCGG + Intergenic
1113541996 13:111115872-111115894 CGGGGCAGGGGGAGGGGGCCGGG + Intronic
1113614182 13:111669537-111669559 GGGGGCAGGGGGCAGGCGGCCGG - Intronic
1113619650 13:111754451-111754473 GGGGGCAGGGGGCAGGCGGCCGG - Intergenic
1113779747 13:112969226-112969248 CTGGGCAGGGAGGCGGCGGCTGG + Exonic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114525572 14:23365460-23365482 GAGGGCTGGGAGAAGCCGCCGGG + Exonic
1117377459 14:55129337-55129359 CGGGCAGGGGAGAGGGCGCCCGG + Intronic
1117546499 14:56798120-56798142 CTGGCCGGGGAGAAGGGGCCGGG - Intergenic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1119441463 14:74631371-74631393 CTGGGGAGGGAGGAGGCCCCAGG + Intergenic
1119652240 14:76392125-76392147 CGGGGCAGGGAGGGGCCTCCAGG + Intronic
1120193938 14:81463204-81463226 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193946 14:81463223-81463245 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193954 14:81463242-81463264 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193962 14:81463261-81463283 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122280938 14:100622102-100622124 CGAAGCAGAGAGAAGGAGCCTGG + Intergenic
1122672745 14:103384970-103384992 CGGGGCTACGGGAAGGCGCCGGG - Intergenic
1122911090 14:104827842-104827864 CGGGGCAGGGAGGAGGGGCTGGG + Intergenic
1122921560 14:104882457-104882479 CCAGGCAGGGAGGAGGGGCCAGG + Intronic
1122925071 14:104895692-104895714 CGGTGCAGCGTGGAGGCGCCTGG - Exonic
1122956316 14:105073188-105073210 ACGGGCAGGGAGCAGGAGCCGGG - Intergenic
1123012715 14:105357109-105357131 AGGGGCTGGGAGGAGCCGCCTGG - Intronic
1123018204 14:105385466-105385488 ATGTGCAGGGAGGAGGCGCCGGG - Intronic
1123630749 15:22258221-22258243 CGGGTCCGGGCGAAGGCGCGCGG - Intergenic
1124158034 15:27245207-27245229 CTGGGCAGGTAGCAGGTGCCAGG + Intronic
1125342992 15:38692827-38692849 GGTGGCAGGGAGAAGGTTCCGGG + Intergenic
1125535581 15:40440039-40440061 CGGGGGAGGGAGAAAGGGGCGGG - Intronic
1126099519 15:45111251-45111273 CGGGGCAGAGAGAGGGAACCGGG - Exonic
1126104008 15:45135786-45135808 CGGGGCAGAGAGAGGGAACCGGG + Exonic
1127752525 15:62060178-62060200 CGGCGCAGGGAGCAGGGCCCGGG + Intronic
1128244481 15:66123855-66123877 TGGGGCAGGGAAAAGGCACTGGG - Intronic
1128264005 15:66252561-66252583 CAGGTCCGGGAGAAGCCGCCCGG + Intronic
1129288765 15:74547153-74547175 CGGGGGAGGGGGAAGGCGGGGGG - Intronic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1130537482 15:84797744-84797766 TGAGGGAGGGAGAAGGTGCCTGG + Intronic
1130981753 15:88816966-88816988 TGGGGAAGGGAGTAGGCTCCTGG - Intronic
1131058465 15:89390276-89390298 GGTGGCAGGGAGAAGGCACAGGG - Intergenic
1131453106 15:92562639-92562661 CTGGAGAGGGAGATGGCGCCAGG + Intergenic
1131827639 15:96333423-96333445 AGAGGCAGGGAGCAGGCGGCCGG - Intronic
1132085932 15:98908158-98908180 TGGGGGAGGGAGAAGGCCCAGGG + Intronic
1132311897 15:100863275-100863297 CGGGGGTGGGAGGAGGTGCCTGG - Intergenic
1132336883 15:101053467-101053489 CGTGCCAGGCAGGAGGCGCCCGG - Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132805074 16:1771560-1771582 CGGGGCGGGGCGGTGGCGCCCGG + Exonic
1132854159 16:2037371-2037393 CGGGGCAGGCACCGGGCGCCTGG - Intronic
1132881392 16:2163177-2163199 GGGGGCAGGGAGAAGGCATGCGG - Intronic
1133011040 16:2912017-2912039 CGGGGCTGGGAGCTGGTGCCCGG + Exonic
1133241292 16:4416065-4416087 GGCGGCAGGGAGGAGGAGCCAGG + Intronic
1133301195 16:4783870-4783892 CGGGGCAGGGAGGAGGAGAAGGG - Intronic
1133341065 16:5036438-5036460 GGAGGCAGGGAGTAGGCGTCAGG - Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134614818 16:15643054-15643076 GGGGGCGGGGGGAAGGCGGCGGG - Exonic
1134656102 16:15949594-15949616 CGGCGCAGGGAGCCGGGGCCGGG - Exonic
1135745694 16:25014922-25014944 CGGGGCAGGGACAATGGGCAGGG + Intronic
1135809877 16:25577397-25577419 CGGGGCACAGAGCAGGCCCCTGG - Intergenic
1136287910 16:29254857-29254879 CGAGGGAGGGAGAAGGGGCGGGG - Intergenic
1137270195 16:46898050-46898072 CTGGGCTGGGAGGAGGCGTCGGG + Intronic
1137848596 16:51715630-51715652 AGGGACAGGGAGGAGGCCCCTGG + Intergenic
1139955296 16:70690300-70690322 TGGGGCAGGGAGAGCGGGCCTGG - Intronic
1140457584 16:75114066-75114088 AGGGGCAGGGTGCAGGCGCAGGG + Exonic
1141159108 16:81617380-81617402 TGGGGCAGGGAGAATTCACCTGG - Intronic
1141372844 16:83503447-83503469 AGGGGCAGTGAGAAGGAGGCCGG + Intronic
1141434762 16:83993752-83993774 CAGGGCCGGGAGATGGGGCCAGG + Intronic
1141452854 16:84117173-84117195 GGGGGCAGGGAGCCTGCGCCAGG - Intergenic
1142399136 16:89850238-89850260 TGGGGCGGGGAGAACGCGGCTGG - Intronic
1142474225 17:180289-180311 CGGGGACGGGAAAAGGCGCCAGG + Intronic
1142586859 17:979454-979476 CGGGGCCGGGAGCGGGGGCCGGG - Exonic
1142671987 17:1491666-1491688 CTGGGCGGGGAGAGTGCGCCCGG - Intronic
1142699400 17:1649938-1649960 CGAGGAAGGGAGAAGGCGTGGGG + Exonic
1142852687 17:2711796-2711818 TGGGGCAGGGAAACGGCGGCGGG - Intronic
1143258698 17:5582884-5582906 AGGGGCAGGGGCAAGGTGCCAGG + Intronic
1143565220 17:7716957-7716979 CGGGGCTGCTAGAAGGCGCCTGG - Intergenic
1143738074 17:8927892-8927914 GGGTGCAGGGGGAAGGTGCCAGG - Intronic
1144475945 17:15589419-15589441 TGGGGCGGGGAGAAGGTACCTGG + Intronic
1144779796 17:17802064-17802086 CCGGGGAGGGAGAAGTCACCAGG - Intronic
1145059622 17:19724493-19724515 CGGTCCAGGGAGCAGGCGCTGGG + Intergenic
1145933654 17:28702808-28702830 TGGGGCAGGGACAAAGGGCCAGG - Intergenic
1146518335 17:33507037-33507059 TGGGGCAGGGTCAAGGGGCCGGG + Intronic
1147657381 17:42098513-42098535 CGGGGCTGGGAGGGGGAGCCGGG + Intergenic
1147793021 17:43025142-43025164 CGGGGGTGGGAGGAGGGGCCGGG + Intergenic
1148048780 17:44759281-44759303 GGGGGCAGGGAGGGGGCGCCGGG - Intronic
1148115491 17:45172509-45172531 TGGGGCAGGAAGAAGCTGCCAGG + Intergenic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1149441591 17:56678836-56678858 CGGGGGAGGGAGGGGGCCCCCGG - Intergenic
1149546067 17:57504787-57504809 CCGGGCAGGTGGCAGGCGCCTGG + Intronic
1149620345 17:58040089-58040111 TGGGGCAGGGAGAAGGGACCTGG + Intergenic
1149990148 17:61378611-61378633 CTGGGCAGGGAGAAGGCTGGTGG - Intronic
1150583638 17:66498137-66498159 CGGGGCAGGGGGCAGGAGGCGGG - Intronic
1150636228 17:66915190-66915212 TGGGGCAGGGAGAGGGAGGCAGG + Intergenic
1151512517 17:74570012-74570034 CGGGGCAGGGAGAGGCTGCAGGG + Intergenic
1151548360 17:74807079-74807101 TGGGGGAGAGAGAAGGCTCCAGG - Intronic
1151591459 17:75047282-75047304 CGGGGCTGGGAGGGGGCGGCGGG + Exonic
1151975768 17:77482852-77482874 CTGGGCAGGGTGAGGGGGCCAGG + Intronic
1152037292 17:77881170-77881192 TGGGGCAGGGAGAATCTGCCAGG + Intergenic
1152113403 17:78369914-78369936 CTGGGCAGGGAGAAGCTGCGGGG + Intergenic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152329706 17:79665393-79665415 CGGAGCAGAGAGGAGGGGCCTGG + Intergenic
1152329714 17:79665423-79665445 CGGAGCAGAGAGGAGGGGCCTGG + Intergenic
1152374447 17:79911900-79911922 CGGGGCAGGGCGGAGGCCCGAGG - Intergenic
1152564219 17:81092989-81093011 GGGGGCAGGGAGCAGGGCCCGGG + Intronic
1152571107 17:81121655-81121677 CCAGGCAGGGAGCAGGTGCCAGG + Exonic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152614516 17:81331609-81331631 TGGGGCAGGGGGAGGGGGCCTGG + Intergenic
1152688163 17:81704854-81704876 CGTGGCAGGGAGTAGGTCCCAGG - Intronic
1152853055 17:82648732-82648754 CGGGGCGGGGAGGAGGGGGCGGG + Intergenic
1152991373 18:366708-366730 GGGGGCAGGGAGATTGCTCCTGG - Intronic
1153224404 18:2887527-2887549 GAGGGAAGGGAGAAGGTGCCAGG - Intronic
1153528157 18:6016909-6016931 AGGGGCATGGAGAAGCAGCCAGG + Intronic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154954569 18:21242063-21242085 CGAGGCAGCGGGAAGGCGCGAGG + Intergenic
1157464182 18:47930498-47930520 CGGGGCGGGAAGACGGCGGCCGG - Exonic
1158434769 18:57428088-57428110 CGGGGCCGGGAGAGGTCGCGCGG + Intergenic
1159051202 18:63422577-63422599 CTGGGCCGGGAGAAGTAGCCTGG + Intergenic
1160500919 18:79400777-79400799 CGGGGCGGGGAGAGGGTGTCTGG - Intronic
1160690834 19:460295-460317 AGGGGCGGGGAGAGGGCGGCGGG - Intronic
1160706408 19:532162-532184 CGGGGCAGGGAGCTGGTTCCCGG - Intronic
1160707573 19:536619-536641 CTGGGTAAGGAGAAGGCCCCAGG - Intronic
1160736239 19:663555-663577 CGGGCGGGGGAGAGGGCGCCTGG - Intergenic
1160810545 19:1011199-1011221 CGGGGCGGGGTGAGGGCGTCGGG + Intronic
1160974679 19:1787012-1787034 TGGGGCGGGGAGAGGGAGCCTGG - Intronic
1161225941 19:3146028-3146050 CGGAGCACGGAGAAGGGGCGGGG - Intronic
1161265076 19:3360084-3360106 CGGGCCAGGGAGGGGGCGCACGG + Intronic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1161497669 19:4596464-4596486 CGGGCCAGGGAGGAGGGGCCTGG + Intergenic
1161571597 19:5033679-5033701 CGGGACAGGGAGGAGGCTCCTGG - Intronic
1161591641 19:5131643-5131665 GGGGGCAGGGAGGAGGGGACAGG + Intronic
1161750498 19:6092725-6092747 CGGGGGAGGGAGAGGCTGCCAGG + Intronic
1161770640 19:6228959-6228981 AGGGGCGGGGAGGAGGCGCGGGG - Intronic
1163012324 19:14433680-14433702 CGGCCCAGGGAGGGGGCGCCGGG - Intronic
1163305061 19:16472459-16472481 CGGGGCAGGGTGAGGGGGGCAGG - Intergenic
1163554053 19:17982681-17982703 GGAGGCAGGGAGAACGGGCCCGG + Intronic
1163726181 19:18924389-18924411 GGTGGCAGGAAGAAGGCGCCCGG - Intronic
1164226404 19:23250032-23250054 CGGGGAAGAGACAAGACGCCCGG + Intronic
1164726477 19:30468971-30468993 CAGGGAAGGGAGAAAGCCCCAGG - Intronic
1165256386 19:34579269-34579291 GGTGGCAGAGAGAAGGCCCCAGG + Intergenic
1165956015 19:39502725-39502747 AGGGGCGGGGAGAATGCGGCCGG + Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166079334 19:40434000-40434022 CTGGGGAGGGAGGAGGCGCCAGG + Intergenic
1166361265 19:42253918-42253940 CGGGGGAGGGGGAAGGGGGCCGG - Intronic
1166835990 19:45668315-45668337 GGGGGCAGGGAGAATGGGCTGGG - Intronic
1167041060 19:47022596-47022618 CGGGGCATGGAGGAGGGGGCGGG + Intronic
1167075141 19:47244019-47244041 CGGGGAAGGGAGAGGGGGGCGGG - Intergenic
1167278311 19:48552132-48552154 CCGGGCACGGAGTAGGCACCTGG + Exonic
1167295505 19:48646713-48646735 AGGGGCGGGGAGGAGGAGCCGGG + Intergenic
1167375403 19:49108288-49108310 CGGGGCAGGGATGAGGCCCGAGG + Exonic
1167534223 19:50039305-50039327 CAGGGCAGTGAGTAGGCCCCTGG - Intronic
1167648547 19:50718308-50718330 CGGGGCAGGGAGGAGGCAGCCGG - Intronic
1167741119 19:51325551-51325573 GGGGCCAGGGAGAAGGGGGCTGG - Intronic
1167960948 19:53103612-53103634 CGGGCCGGGGAGGAGCCGCCGGG + Intergenic
1168324141 19:55529721-55529743 CTGGGCAGTGAGGAGGCCCCGGG - Exonic
925058115 2:871122-871144 GGCGGCAGGAAGACGGCGCCGGG + Intergenic
925262898 2:2543329-2543351 CTCGGCAGGAAGATGGCGCCCGG + Intergenic
925885710 2:8392413-8392435 GGGGGCAGGGAGGAGACCCCTGG - Intergenic
926109729 2:10174111-10174133 CGTGGCAGAGAGAAGGTGGCAGG - Intronic
926316552 2:11714544-11714566 CAGGGCAGGGTGAAGGCCCGAGG - Intronic
927147756 2:20178123-20178145 CGAGGCAGGGAGAAGTTCCCGGG + Intergenic
927956613 2:27211821-27211843 CGGGGCGGGGACAAGGGGGCGGG - Intronic
928158083 2:28894750-28894772 CTGTGCGGGGAGAAGGCGCAAGG - Exonic
928924140 2:36559717-36559739 CGGGCCAGGGTGCAGCCGCCTGG - Intronic
929822258 2:45282930-45282952 CTGGGCAGGGAGCAGGCCTCAGG - Intergenic
929858063 2:45652075-45652097 CGGGGCGGGGAGTGGGGGCCGGG - Exonic
930136200 2:47905952-47905974 CGGGGAAGGCCGAAGCCGCCGGG + Intergenic
932568777 2:72925644-72925666 CCGGGCAGTGAGAAGATGCCCGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933260643 2:80127602-80127624 AGGGGCAGGAAGAAGGGGCTAGG - Intronic
933770830 2:85742881-85742903 TGGGGCGGGGAGAGGGTGCCAGG + Intergenic
934040963 2:88127149-88127171 GGGGGCAGGGAGCATGCTCCAGG - Intronic
936444808 2:112587094-112587116 AGGGGCAGAGAGAGGGCCCCAGG - Intronic
938018379 2:127885951-127885973 CGGGGCGGGGCGAAGGAGGCCGG + Intergenic
938207757 2:129438537-129438559 CTGGGGAGGGAGAGGGAGCCTGG - Intergenic
939178752 2:138780723-138780745 CGGGGGTGGGAGGAGGCACCCGG - Intergenic
942150938 2:173075743-173075765 CGGGGCGTGGGGAAGGCGCTCGG - Intronic
944159073 2:196639860-196639882 CAGGACAGGGAGAGGGCGCCAGG - Intronic
944615239 2:201452241-201452263 GGGTGCGGGGAGAGGGCGCCCGG - Intronic
945028033 2:205637920-205637942 AGGGGCAGGGCGAAGGAACCTGG - Intergenic
945119517 2:206443583-206443605 CGGGGGAGGGAGTAGCCGCTGGG + Exonic
945143464 2:206712559-206712581 TGGGTCAGGGAGGAGGAGCCAGG + Intronic
946161149 2:217836825-217836847 TGGGGCAGGGAAAAGGGGGCGGG - Intronic
946737898 2:222772960-222772982 GGACGCAGGGAGAAGGCGGCCGG + Intergenic
947544306 2:231000482-231000504 CGGGACTGGCAGATGGCGCCAGG + Exonic
948795151 2:240398869-240398891 CGGGGCAGCCCGCAGGCGCCAGG + Intergenic
948942093 2:241201710-241201732 CGGGGCAGGCCCAAGGCACCCGG + Intronic
1169214836 20:3786824-3786846 GAGGGCGGGGAGGAGGCGCCGGG - Intronic
1171181983 20:23097808-23097830 CGGGTCATGGAGGAGGCTCCTGG + Intergenic
1171237007 20:23535257-23535279 GGGGGCAGGGAGAAGTTCCCAGG + Intergenic
1171377329 20:24702505-24702527 GGGGGCAGGGAGCAGGGGACAGG + Intergenic
1172149446 20:32779921-32779943 CTGAGCAGGGAGAGGGGGCCAGG + Intronic
1172583473 20:36065865-36065887 CGGGGCTGGGAGGAGGCCGCAGG + Intergenic
1172690122 20:36784308-36784330 TGGGGCATGGAGGAGGCGGCTGG + Exonic
1172791063 20:37505930-37505952 CGGGGCAGTGAGAGGGGCCCTGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1173961175 20:47073724-47073746 CGGGGCAGGCAGGAAGTGCCTGG + Intronic
1174360117 20:50023557-50023579 CTGGGCAGAGAGAGGGCCCCTGG + Intergenic
1174377878 20:50138557-50138579 CTGGGCAGCGTGCAGGCGCCAGG - Intronic
1174776246 20:53345720-53345742 AGGGGCAGGGAGGAGGCTCTTGG - Intronic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1175547574 20:59788508-59788530 CGGGTCAGGGAAGAGGGGCCAGG - Intronic
1175904749 20:62374238-62374260 CGGGGCAGTGGGAAGGTGACGGG - Intergenic
1176016710 20:62937731-62937753 TGGGGCGGGGGAAAGGCGCCGGG - Intronic
1176061649 20:63175306-63175328 GGCGGCGGAGAGAAGGCGCCGGG + Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176200028 20:63855910-63855932 CGGGGAGGGGAGAAGGTGCAGGG + Intergenic
1176379055 21:6102581-6102603 TGGGGCTGGGAGAGGGCTCCAGG - Intergenic
1176515457 21:7780471-7780493 GGGAGCAGGGAGGAGGGGCCAGG - Intergenic
1178649485 21:34410483-34410505 GGGAGCAGGGAGGAGGGGCCAGG - Intergenic
1179125073 21:38583265-38583287 TGGGGCAGGAAGAAGGAGGCAGG + Intronic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179445424 21:41426977-41426999 CGGGGGTGGCAGAAGGAGCCCGG + Intronic
1179731835 21:43372557-43372579 GGGGTCAGGGAGATGGGGCCTGG - Intergenic
1179744419 21:43435656-43435678 TGGGGCTGGGAGAGGGCTCCAGG + Intergenic
1179786831 21:43734950-43734972 TGGAGCAGGGAGGAGGGGCCTGG + Intronic
1179828083 21:43979424-43979446 TGGGGCAGGCAGAAAGCACCAGG - Intronic
1179967264 21:44814717-44814739 CAGGGCAGCGAGAAGGAGCCTGG - Intronic
1180042438 21:45287428-45287450 AGGGGCAGGGGGCAGGGGCCAGG - Intronic
1181183109 22:21080851-21080873 TGGGGCAGGGACAATGGGCCCGG + Intergenic
1181645794 22:24231341-24231363 CGGGGGAGGGGGTGGGCGCCAGG + Intronic
1182338850 22:29603521-29603543 CGGGGCCGGGAGCAGGCCCCGGG + Intergenic
1183085824 22:35486386-35486408 AGGGCAATGGAGAAGGCGCCTGG - Intergenic
1183363785 22:37396648-37396670 CGGGGCAGGAAGGGGGCGCCTGG - Intronic
1183486347 22:38089361-38089383 GGGGGCGCGGAGAACGCGCCGGG + Intronic
1183511960 22:38241161-38241183 CAGCACAGGGAGAAGGCACCAGG + Intronic
1183589348 22:38770730-38770752 GGGGGCAGGGAGCACGCGCCAGG - Intronic
1183607043 22:38872016-38872038 CGGGGCTGGGCGAGGGAGCCGGG + Intronic
1183948761 22:41341065-41341087 CTGGGCAGGGAGAAGACACAGGG - Intronic
1184036206 22:41919549-41919571 CGTGGGAGGGAGGGGGCGCCCGG + Intergenic
1184090293 22:42289772-42289794 CGGGGCAGGCTGCAGGCTCCTGG - Intronic
1184152403 22:42646584-42646606 CAGGGCAGGGAGCTGGCACCTGG - Intronic
1184409910 22:44320414-44320436 GGGGGCAGGGAGGAGGTGCGAGG + Intergenic
1184587799 22:45459535-45459557 GGGTGGAGGGAGAAGGAGCCAGG + Intergenic
1184647446 22:45903781-45903803 GGGGGCAGCGAGAAGGGGCCGGG + Intergenic
1184677919 22:46053690-46053712 CTGGGGAGGGAGAGGGCCCCAGG - Intronic
1185190443 22:49433040-49433062 CCGGGCAGGGAGAGGGCGGATGG - Intronic
1185287570 22:50009406-50009428 TGGGTGAGGCAGAAGGCGCCCGG + Intronic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950509255 3:13415919-13415941 TGGGGCAGGGAGAGGGACCCAGG + Intronic
950584038 3:13880252-13880274 CGGAGCAGGGAGGGGGCCCCCGG - Intergenic
952902136 3:38117467-38117489 GGGGGCAGCCAGAAGGCCCCAGG + Intronic
953670070 3:44955056-44955078 GTGGGCAAGGAGAAGGCGTCAGG + Intronic
953680716 3:45036099-45036121 CGGGGCGGGGAGGAGGTCCCAGG + Intergenic
953881541 3:46693736-46693758 CGGGGCTGGGCGAAGGGGGCGGG - Intergenic
953908897 3:46882214-46882236 CGGGGGAGGGAAGAGGCGCCCGG + Intronic
954810041 3:53241994-53242016 ACGAGCAGGGAGAAGGCACCTGG + Intronic
955106115 3:55900168-55900190 TGGGGCAGGGTGGAGGCGGCAGG - Intronic
956661870 3:71606864-71606886 CGGAGCAGGGAGCAGGGGCAGGG + Intergenic
956711727 3:72044192-72044214 GGGGGCAAGGAGAAGGCTACTGG - Intergenic
960829846 3:121834922-121834944 CTGGGGAGGGAGAGGGCCCCAGG - Intronic
961477009 3:127153257-127153279 AGGGGCAGATAGAAGGCGCTGGG + Intergenic
961574479 3:127823285-127823307 CGGCGCGGGGAGGCGGCGCCCGG + Intergenic
963004329 3:140711885-140711907 GGGGCCAGGGAGAAGGCGGTTGG - Intergenic
965520001 3:169662231-169662253 CCGGGCAGGCAGGGGGCGCCGGG + Intronic
966246404 3:177812814-177812836 CTGGGCAGGGAGGAGGAGCCAGG + Intergenic
966314038 3:178625299-178625321 GGGGGCGGGGAGAAGACCCCAGG + Intronic
966932950 3:184687546-184687568 CAGGGCAGGGAAATGGAGCCTGG - Intergenic
967803912 3:193696464-193696486 TGGGGCATGGAGAGGGCGTCAGG - Exonic
967972868 3:195012214-195012236 GGGGGCAGGGAGCAGGCAGCTGG - Intergenic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968084433 3:195868059-195868081 CCGGGCTGGGAGAGGGGGCCGGG + Exonic
968284243 3:197498938-197498960 AAGGGCCGGGAGGAGGCGCCGGG + Intergenic
968293542 3:197556184-197556206 AGGGCCAGGGAGATGGAGCCAGG + Intronic
968659624 4:1793669-1793691 CGCGGCGGGGAGGAGGCGGCCGG + Intronic
968662015 4:1802572-1802594 GGGGGCGGGGAGCAGGCGCAGGG + Intronic
968715796 4:2158523-2158545 CGTTGCAGGGAGAAAGGGCCAGG + Intronic
968860031 4:3160495-3160517 TGGGGCAGGGAGGAGTCTCCCGG - Intronic
969016631 4:4107784-4107806 TGGGGCAGGGAGGAGGTGCAGGG - Intergenic
969330515 4:6471589-6471611 AGTGGGAGGGAGAAGGCGGCTGG - Intronic
969596005 4:8149608-8149630 GGGGGCAGGCAGAAGGCGGCAGG + Intronic
969626610 4:8308935-8308957 AGGGGCAGGGAGAAGGAGGGTGG - Intergenic
969659038 4:8515648-8515670 CGGGGCAGGGAGCAGAGGCTGGG + Intergenic
973680212 4:53309526-53309548 CGGTGCAGGGAGGAGGAGTCAGG + Intronic
973871683 4:55172780-55172802 CGCAGCAGGGAGAAGGAGCCAGG - Intergenic
975281474 4:72568051-72568073 GGGGGAGGGGAGAAGGCGGCCGG + Intronic
975584943 4:75940346-75940368 GGGGGCGGGGGGAAGGCGGCGGG + Intronic
980493482 4:133560651-133560673 AGGAGCAGGGAGAGGGAGCCAGG + Intergenic
984709631 4:182874302-182874324 CGGGGCAGGGATTAGGCCCCCGG - Intergenic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
985171748 4:187157567-187157589 CGGCGCAGGGAGCATGCGCAGGG + Intergenic
985605738 5:857273-857295 GGGGGCAGACAGGAGGCGCCTGG - Intronic
985971412 5:3381326-3381348 AGGGGCAGGGAGAGGGCTCCAGG - Intergenic
986773510 5:10994359-10994381 CGGGGAAGGAGGAAGGGGCCGGG + Intronic
991054407 5:62306212-62306234 CGGGGCCGTGAGACGGCGCGGGG - Intronic
994171414 5:96662616-96662638 CGGGGCAGGGAGAGGGCTAGGGG + Intronic
997597067 5:135114133-135114155 CAGGGCAGAGAGAAGCCGCCAGG + Intronic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998265554 5:140665111-140665133 CGGGGCAGGGCCGGGGCGCCGGG + Intronic
999156994 5:149465036-149465058 GGGGGCAGGGAGAAGCCACCAGG + Intergenic
999730534 5:154473786-154473808 CGACGCTGGGACAAGGCGCCTGG + Intergenic
1000096778 5:157978229-157978251 AGGGGCAGGGGACAGGCGCCAGG + Intergenic
1000255139 5:159530356-159530378 CTGAGGTGGGAGAAGGCGCCTGG - Intergenic
1002048450 5:176555307-176555329 TGAGGCAGGGAGAAGGAGGCAGG - Intronic
1002102492 5:176864301-176864323 CGGGGCAGGCAGCAGTGGCCAGG + Intronic
1002593425 5:180306520-180306542 TGGGGCAGGGACAGGGTGCCAGG - Intronic
1002648476 5:180674048-180674070 GGGCGCGGGGAGAAGGCGGCGGG + Intergenic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002718961 5:181246560-181246582 CCGGGCCGGGAGACGGCGGCAGG - Intronic
1003086374 6:3064288-3064310 AAGGGCAGCGAGGAGGCGCCGGG - Intronic
1004620414 6:17326157-17326179 AGGGGCAGGGGGAAGTCGGCAGG + Intergenic
1004864413 6:19838375-19838397 CGGGTCCGGGAGAACGCGCAGGG + Intronic
1004947042 6:20626975-20626997 CGGGGAAGGGAGAAGGAGTTTGG + Intronic
1006147051 6:31965917-31965939 CCGGGCAGGGCGGAGGGGCCTGG + Exonic
1006436012 6:34026564-34026586 CTGGGCAGGAAGCAGGGGCCTGG + Intronic
1006639074 6:35479764-35479786 GTGGGCAGGGAGGAGGCCCCGGG - Intronic
1007664327 6:43505552-43505574 CGGGTCGGGCAGAAGGTGCCTGG - Exonic
1011517259 6:88167024-88167046 CGGGCGCTGGAGAAGGCGCCTGG - Intergenic
1011603344 6:89080368-89080390 GGGGGCAGGGGGAGGGCGGCAGG - Intergenic
1011663013 6:89610269-89610291 CGGGGCTGGGAGAGGGTGACTGG - Intronic
1013227971 6:108134194-108134216 CGGGGCAGGGAGAGGGGCGCGGG - Intronic
1013273161 6:108560789-108560811 CGGGGCGGGGAGAAGGGGGAGGG - Intronic
1015244665 6:131062980-131063002 GGGGGCGGGGAGAGGGGGCCCGG - Intronic
1015880576 6:137867057-137867079 CGGGGCAGGGAAAGGGGGCGGGG + Intergenic
1015897975 6:138035218-138035240 GGGGGCAGGGAGGATGCTCCAGG - Intergenic
1016618355 6:146079056-146079078 GGGAGCAGGGAGGAGGAGCCTGG - Intronic
1018158733 6:161015693-161015715 CGGGGCGGGGGGAAGGTGCCAGG + Intronic
1018825313 6:167404402-167404424 CGAGACAGGGAGGAGGTGCCAGG + Intergenic
1019114840 6:169751698-169751720 CTAGGCAGGGAGTCGGCGCCAGG + Intronic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019293624 7:262334-262356 AGGGGCAGGGAGGAGGCGTGTGG + Intergenic
1019537775 7:1537999-1538021 ACGGGCGGGCAGAAGGCGCCGGG - Intronic
1019595576 7:1856858-1856880 TGGGGGAGGGAGAGGGAGCCTGG + Intronic
1019728218 7:2614901-2614923 CGTGGCAGGGAGCTGGCGGCGGG - Intergenic
1019747634 7:2709495-2709517 TGGGGCAGGGGGAGGGCGCCTGG + Intronic
1020241994 7:6402208-6402230 GGGAGCCGGCAGAAGGCGCCCGG + Intronic
1021716934 7:23469605-23469627 CGGGGCCTGGAGCACGCGCCTGG + Intronic
1022096025 7:27142342-27142364 CGGGGCAGGGCGGAGGGGGCAGG - Intronic
1022502231 7:30889040-30889062 AGGGGCGGGGTGAAGGGGCCTGG + Intronic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1024227285 7:47335588-47335610 CGGGGGACGGAGAAGGCCCCTGG - Intronic
1025007483 7:55365777-55365799 GGGAGCAGGGCAAAGGCGCCAGG + Exonic
1025258910 7:57404224-57404246 CGGGGCGAGGAGAAGGGGCGGGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026891647 7:73985996-73986018 AGGGGCAGGGAGCTGGCACCGGG + Intergenic
1031083314 7:117278758-117278780 TGAGGTAGGGAGAAGGAGCCAGG - Intronic
1031586350 7:123535154-123535176 AGCGGCAGGGAGAAGGGGCGGGG + Intergenic
1033306650 7:140230527-140230549 CGGGGCGGCGAGAGTGCGCCGGG - Intergenic
1034188235 7:149195515-149195537 CCGGAGAGGGGGAAGGCGCCTGG + Exonic
1034263623 7:149771745-149771767 CGGGGCAGAGGGAAGGCTGCCGG - Intronic
1034349279 7:150405782-150405804 GGGGGCGGGGAGAAGGGGCGCGG + Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1035828860 8:2673074-2673096 TGAGGAAGGGAGAAGGCCCCTGG + Intergenic
1036163066 8:6406823-6406845 CGGGGGAGGAAGGAGGCGGCAGG - Intronic
1036182494 8:6597526-6597548 CTGGGCTGGGAGAGGGCTCCGGG - Intronic
1036259427 8:7228362-7228384 CGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1036310420 8:7680814-7680836 CGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1036311469 8:7686932-7686954 CGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1036543301 8:9740426-9740448 AGGGCCAGGGAGAAGGCGGTAGG - Intronic
1036621015 8:10424591-10424613 AGGGACAGGGAGAAGGGGCCAGG + Intronic
1037934957 8:22909264-22909286 TGGGGTAGGGAGAAGGACCCTGG - Intronic
1038151074 8:24942570-24942592 CGGGGGAGGGAGGAGGCGCCGGG - Intergenic
1038459665 8:27705213-27705235 AGGGGCAGGTCGAAGGAGCCTGG + Intergenic
1039546335 8:38413835-38413857 CTGAGCAGGGAGGAGGGGCCCGG - Intronic
1039721481 8:40169079-40169101 CGGGGAAGGTAGAAAGTGCCTGG + Intergenic
1041060912 8:54033518-54033540 CAGGGCAGGGAGGAAGTGCCAGG + Intergenic
1042679177 8:71361821-71361843 CGGCGCAGGGGGCAGGCGCCTGG + Exonic
1045507588 8:102789419-102789441 CGGGGCTGGGAAAAGGCCCTGGG - Intergenic
1046556496 8:115779625-115779647 AGCGGCAGGCAGAAGGAGCCAGG + Intronic
1048009240 8:130443226-130443248 CGGGGCCGGGCGAGGCCGCCCGG - Intronic
1049591930 8:143466612-143466634 AGGGGCAGGGAGATGTCTCCTGG - Intronic
1049711066 8:144063574-144063596 TGCGGCGGGGAGAAGGTGCCAGG - Intronic
1051501822 9:17786425-17786447 CGTGGCCAGGAGAAGGGGCCAGG + Exonic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051855517 9:21559934-21559956 AGGGGGAGGGAAGAGGCGCCTGG + Intergenic
1053482246 9:38424265-38424287 CCGGGCAGGGCGCAGGCGCCGGG + Exonic
1053729440 9:41037964-41037986 AGGGGTAGGAAGAAGGCACCGGG - Intergenic
1054458613 9:65450051-65450073 GGGGGCAGGGTGCAGGCACCAGG - Intergenic
1054699069 9:68394102-68394124 AGGGGTAGGAAGAAGGCACCGGG + Intronic
1054718995 9:68584894-68584916 GGGGGCAGGGAGGGGGTGCCAGG + Intergenic
1055174020 9:73295886-73295908 AGGGGCAGTGAAAAGGCACCAGG - Intergenic
1055611860 9:78031850-78031872 CGGGGCAGGGGGTGGGCGTCTGG - Intergenic
1056791910 9:89631457-89631479 CAGGACAGGGAGGAGGTGCCTGG + Intergenic
1061216098 9:129222878-129222900 CGGGGAAGGGAGGGGGAGCCGGG - Intergenic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061876255 9:133545573-133545595 CGGGCCAGGGAGTAGCCCCCAGG - Intronic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062325585 9:136011036-136011058 CGGGGCAGGGCTCAGGCTCCAGG - Exonic
1062564524 9:137158263-137158285 AGGAGCAGGGAGAAGGAGCAGGG + Intronic
1185469005 X:371469-371491 CGGGGCAGGCAGCACCCGCCAGG + Intronic
1185761338 X:2691527-2691549 CCGGGCAGGGAGGAGGCTCCGGG - Intronic
1186660941 X:11666312-11666334 CCGGGTAGGGGGCAGGCGCCGGG + Intergenic
1187412260 X:19061834-19061856 GGCAGCAGGGAGAAGGGGCCTGG + Intronic
1189357724 X:40324116-40324138 CGGGGCAGGATGAAAGTGCCAGG + Intergenic
1190222582 X:48521922-48521944 TGGGGGAGGGAGCAGGGGCCGGG - Intronic
1192165978 X:68828079-68828101 CGGGGCGGGAAGAATGGGCCAGG + Intergenic
1192214822 X:69150783-69150805 CTTGGCAGGGAGCAGGCGGCAGG + Intergenic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1195343479 X:103926550-103926572 TGGAGCAGGGAGAAGGGGCTAGG + Intronic
1195363489 X:104106769-104106791 TGGAGCAGGGAGAAGGGGCTAGG - Intronic
1199130716 X:144182842-144182864 GCGGGCAGGGAGATGGAGCCTGG - Intergenic
1199724607 X:150568481-150568503 GGGGGCAGGAAGAGTGCGCCGGG - Intergenic
1200069030 X:153518672-153518694 CAGGGCAGGGGCATGGCGCCGGG + Intronic
1200256554 X:154585737-154585759 CGGGGAGGGGAGCAGGGGCCAGG + Intronic
1200261215 X:154618666-154618688 CGGGGAGGGGAGCAGGGGCCAGG - Intronic
1200276342 X:154736671-154736693 AGGGGCAGGGAGAATAAGCCAGG + Intronic
1200630227 Y:5574193-5574215 CCGGGCAGAGAGACAGCGCCAGG + Intronic
1201274747 Y:12286858-12286880 CTGGGCCGGGAGAAGTCGGCAGG + Intergenic
1201963590 Y:19708001-19708023 CGGTGGATGGAGAAGGCGCTGGG - Exonic