ID: 1022926407

View in Genome Browser
Species Human (GRCh38)
Location 7:35059485-35059507
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 4, 1: 1, 2: 2, 3: 46, 4: 503}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022926407_1022926412 3 Left 1022926407 7:35059485-35059507 CCTCCCACTCTCAGCCCTGCAAG 0: 4
1: 1
2: 2
3: 46
4: 503
Right 1022926412 7:35059511-35059533 ACCCAAGCCGAGCAGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022926407 Original CRISPR CTTGCAGGGCTGAGAGTGGG AGG (reversed) Intergenic
900294511 1:1942274-1942296 CGTGCATGGCTTGGAGTGGGTGG - Intronic
901012424 1:6209307-6209329 CGTGCAGGGCTGCGAGCGGCTGG + Exonic
901653523 1:10756302-10756324 CTTGCGGGGGCGAGGGTGGGGGG - Intronic
901773156 1:11541266-11541288 GCTGCAGGGCTGAGGGTGGAGGG + Intergenic
901810970 1:11766622-11766644 CTGGCTGGGCTGGGGGTGGGCGG - Intronic
903271180 1:22189327-22189349 CTTGCAGAGCTGAGCTTGGCTGG + Intergenic
903976061 1:27151025-27151047 CTTGTAGGGATAAGGGTGGGGGG - Intronic
903978166 1:27165552-27165574 TTGGCAGTGCTGGGAGTGGGTGG - Intronic
904035869 1:27558236-27558258 CTTGCAGGACAGGGAGGGGGCGG - Intronic
904297843 1:29533439-29533461 ATTGAAGGGTGGAGAGTGGGAGG - Intergenic
904342516 1:29846032-29846054 CCTGCAGGGCTGACGGTGGCTGG - Intergenic
905794529 1:40808157-40808179 CTGGCAGGGCTCAGTCTGGGAGG + Intronic
906513501 1:46424593-46424615 CTGGCTGGGCTGAGACTGGCAGG + Intergenic
907015171 1:51005436-51005458 CTTGCAGGGCTCTGTGGGGGTGG - Intergenic
907509874 1:54950192-54950214 GGTGCAGGCCTGTGAGTGGGGGG + Intergenic
908434930 1:64096384-64096406 ATTGGAGGGTGGAGAGTGGGAGG - Intronic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
912624179 1:111194251-111194273 CTTGCAAGGCTGAGGGAGGGTGG - Intronic
913345254 1:117802803-117802825 CTTGCAGCCCTGAGTGTGGGTGG - Intergenic
914005568 1:143729660-143729682 CTAGGAGGGCTGGGGGTGGGGGG - Intergenic
914300944 1:146376694-146376716 CTAGGAGGGCTGGGGGTGGGGGG + Intergenic
914393427 1:147242501-147242523 CTTGCAGTGCGGAGCGTGGAAGG - Intronic
915312489 1:155011523-155011545 CTAGCAGGCCTGACAGTGAGGGG + Intronic
915361411 1:155288265-155288287 GTTGGGAGGCTGAGAGTGGGCGG - Exonic
915514069 1:156402445-156402467 CTGGCAAGGCTAGGAGTGGGAGG + Intergenic
915913788 1:159929609-159929631 GTAGCAGGGCTGAGGGTGGAGGG + Intronic
916216496 1:162399653-162399675 GTTGGAGGGCTCAGGGTGGGAGG - Intronic
916785835 1:168086524-168086546 GTGGCAGGGCAGAGAGTGGCTGG - Intronic
917051075 1:170924218-170924240 TTTGGAGGGTGGAGAGTGGGAGG + Intergenic
917284888 1:173413454-173413476 TTTTCAGCACTGAGAGTGGGAGG - Intergenic
917643042 1:177001743-177001765 CCTGCAGGGCAGAGTGTAGGGGG + Intronic
917736094 1:177921585-177921607 CTGGCAGTGCTGAGAGAAGGGGG + Intergenic
919821660 1:201476804-201476826 ATTAAAGGGCTGAGCGTGGGAGG - Intergenic
919986794 1:202681228-202681250 CTTTCAGGGATGGCAGTGGGAGG - Intronic
920762982 1:208803757-208803779 CTTTCAGGGCTGGGTGTAGGCGG + Intergenic
922136923 1:222837953-222837975 CATGCAGGGATGAGAAAGGGTGG - Intergenic
922223791 1:223628118-223628140 CTGGCAGTACGGAGAGTGGGTGG - Exonic
922549603 1:226484343-226484365 CTGGCAGGGCTGACAGCAGGAGG - Intergenic
923017125 1:230135592-230135614 CTTGTGGAGCTGAGTGTGGGGGG + Intronic
923144896 1:231190897-231190919 CTCACAGGGATGAGAGAGGGAGG - Intronic
923283201 1:232464951-232464973 CCTGCAGGGATGTGATTGGGTGG - Exonic
924044294 1:240011795-240011817 CTTGGAGGACTGAGACTTGGGGG - Intergenic
1062774436 10:134490-134512 CTTGCAGGGCTGCTGATGGGTGG + Exonic
1063711286 10:8481453-8481475 TTTGCACGTCTGAGAGTGGCAGG - Intergenic
1063773265 10:9228919-9228941 CCTGGAGGGAAGAGAGTGGGTGG - Intergenic
1065628253 10:27653244-27653266 CCTGCATGGCAGGGAGTGGGTGG - Intergenic
1065758408 10:28957289-28957311 CTGTCAGGGGTGGGAGTGGGGGG + Intergenic
1066179316 10:32944287-32944309 CTGGCAGCGCTGCTAGTGGGCGG - Intronic
1066497616 10:35957638-35957660 CATGCAGGGCGGTGAGTGTGGGG + Intergenic
1067283915 10:44893925-44893947 CTTGCAGGCCTGGGAGTGACAGG - Intergenic
1068101382 10:52558530-52558552 ATTGGAGGGTGGAGAGTGGGAGG - Intergenic
1068512470 10:57984050-57984072 CTTGCAAGGGGGAGAGTAGGAGG - Intergenic
1069834418 10:71299598-71299620 GTTGCCGGGCTGAGGGTGGGGGG - Exonic
1070441110 10:76444279-76444301 TTTGCTGGGCTGAGCCTGGGTGG - Intronic
1071403400 10:85301759-85301781 CTAGCAGAGCTGAGAATTGGAGG + Intergenic
1071501320 10:86206287-86206309 CTGGGAGACCTGAGAGTGGGTGG - Intronic
1071573547 10:86710792-86710814 ACAGCAGGGCTGAGTGTGGGCGG + Intronic
1073426880 10:103460256-103460278 CTCGTGGGGCTGGGAGTGGGGGG + Intergenic
1074570032 10:114615929-114615951 CTTGCAGGGAGGAGTTTGGGTGG + Intronic
1075092398 10:119451050-119451072 CTGGCAGGGATGACTGTGGGGGG - Intronic
1076264723 10:129100605-129100627 CTTGCAGGAGAGAGAGTGGCAGG - Intergenic
1076330916 10:129665545-129665567 CTTACAGGACTGACTGTGGGAGG + Intronic
1076469668 10:130709799-130709821 CCTATAGGGCAGAGAGTGGGAGG - Intergenic
1076608685 10:131706691-131706713 CAAGCAGAGCTGAGAGTGTGTGG + Intergenic
1076771945 10:132670561-132670583 CTTGCTGGGGGGAGAGTGGTTGG + Intronic
1076921273 10:133455916-133455938 CTTGGGAGGCAGAGAGTGGGTGG + Intergenic
1077101363 11:823984-824006 CCAGCAGGGCTGCGGGTGGGCGG - Exonic
1077367563 11:2167285-2167307 CTTGCAGGGCTCAGAATGTTGGG - Intronic
1077406148 11:2383372-2383394 CTTGGTGGGCAGAGAGTGAGGGG + Intronic
1077643848 11:3905852-3905874 CTTGCAGGGGGCAGGGTGGGTGG + Intronic
1077914267 11:6601047-6601069 GATGCAGGCCTGAGAGTGGAAGG + Exonic
1078638865 11:13077171-13077193 CTCGCAGGGCTGAGGAAGGGAGG + Intergenic
1079688902 11:23398131-23398153 TTTGCGGGGATGAGGGTGGGGGG - Intergenic
1080399768 11:31922876-31922898 GGTGCAGGGGTGAGAGTGGAGGG + Intronic
1080721408 11:34852760-34852782 CTTGGAGGGTGGAGAGTGGGAGG + Intergenic
1081632749 11:44700880-44700902 CTTGCAGGGCAGGGTGGGGGTGG - Intergenic
1082269998 11:50160152-50160174 AATGCAGGGCTGGGAGTGTGTGG + Intergenic
1082661741 11:55920428-55920450 CTTGCAGTGTGGAGAGTGGTTGG - Intergenic
1083281349 11:61629047-61629069 ATTGCAGGGGTGAGGGTGTGTGG + Intergenic
1083437085 11:62649917-62649939 GTTCCCGGGCTGAGAGTTGGTGG + Exonic
1083816827 11:65137547-65137569 CCTGAAGGGCAGAGTGTGGGAGG - Intergenic
1084198375 11:67539353-67539375 CCTGCAGGGCAGGGAGTGTGAGG - Intergenic
1084765566 11:71305959-71305981 CTGGAAGGGCTGTGGGTGGGGGG + Intergenic
1086546184 11:87970332-87970354 CTAACAGGGCTAAGATTGGGGGG - Intergenic
1087044503 11:93833469-93833491 CTTGAGTGGCTGAGGGTGGGAGG + Intronic
1087046158 11:93845578-93845600 CCAGCAGGAATGAGAGTGGGAGG - Intronic
1087252135 11:95914391-95914413 CCTGCAGGGCAGGGAGTGGTGGG + Intronic
1087791650 11:102412062-102412084 TTCGCAGAGCTGAGAATGGGTGG - Intronic
1088124085 11:106402953-106402975 TGCGTAGGGCTGAGAGTGGGAGG - Intergenic
1089363826 11:117909045-117909067 CTTGCAGAGGAGATAGTGGGGGG - Intronic
1089766044 11:120766379-120766401 CTTGCTGGGCTCAGTGAGGGTGG + Intronic
1089834447 11:121357665-121357687 GGTGCAGGGCTGAGAGTCGGTGG + Intergenic
1090280193 11:125449147-125449169 CTTGGGAGGCTGAGAGGGGGAGG - Intronic
1092697841 12:11193163-11193185 CTTGGAGGGTGGAGGGTGGGAGG + Intergenic
1093525844 12:20102646-20102668 CTGGCAGGGCTGGGAATAGGTGG - Intergenic
1093975431 12:25415779-25415801 TTTGCAGGGATGACAGTGAGAGG - Intronic
1094723248 12:33086781-33086803 TTTGGAGGGTAGAGAGTGGGAGG - Intergenic
1095136390 12:38609615-38609637 CGTGGAGGGTTGAGAGTGGGAGG + Intergenic
1096071763 12:48779555-48779577 CTGGCAGGGCTGAGTGTCAGAGG - Intronic
1096156704 12:49345295-49345317 TTGGCAGGGCTGAGCGGGGGAGG - Intergenic
1096406345 12:51346729-51346751 CTGGCAGGGCTGAGGGTGCAAGG + Intergenic
1096497615 12:52047540-52047562 CTTGCAGGGGTGGGAGATGGTGG - Intronic
1096917571 12:55049778-55049800 CATGCGGGGTGGAGAGTGGGGGG + Intergenic
1097370413 12:58771987-58772009 TTTGGAGGGTTGAGGGTGGGAGG + Intronic
1097964038 12:65560179-65560201 CTAGAAAGGGTGAGAGTGGGTGG + Intergenic
1098171950 12:67755977-67755999 CTTGGAGGCTAGAGAGTGGGAGG - Intergenic
1098459024 12:70711386-70711408 ATTGGAGGGTAGAGAGTGGGAGG + Intronic
1098954435 12:76675083-76675105 CTTGCAGTGCTGATAGTGGCAGG + Intergenic
1100137681 12:91573725-91573747 CTTGCAGAGGTTAGGGTGGGAGG + Intergenic
1100478645 12:94956840-94956862 CCTGCAGAGCTGAGAATGGTGGG + Intronic
1101348932 12:103910193-103910215 CTTCCAAGGATGAGACTGGGAGG + Intergenic
1101440885 12:104703623-104703645 CTTGGAGGTGTGAGTGTGGGAGG - Intronic
1101874384 12:108589155-108589177 CTGGCTGGGCTGAGAAAGGGAGG + Intergenic
1103156982 12:118693971-118693993 CTTTAAGGGCTGAAAGTGTGTGG + Intergenic
1104513988 12:129406793-129406815 CTTGCACAGCTCAGAGTGAGTGG - Intronic
1104595410 12:130117026-130117048 CCAGCAGGGCAGAGGGTGGGCGG + Intergenic
1105365806 13:19763482-19763504 CTTGAAGGACTGAGAGAGAGAGG + Intronic
1105638100 13:22235732-22235754 TCTGTGGGGCTGAGAGTGGGTGG + Intergenic
1106174796 13:27321010-27321032 AGTGCAGGGCTGAGAGCAGGAGG + Intergenic
1106736289 13:32590864-32590886 ATTGCAGGGGTGAGAGTTGCAGG + Intronic
1109031772 13:57199630-57199652 TTTGCTGGGCTCAGAGTGAGTGG - Intergenic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG + Intronic
1113065643 13:106371755-106371777 TTTGCAGGGCCGAGGGTGGCTGG - Intergenic
1113285635 13:108845457-108845479 CTTGCAGGGCGGACAGCAGGAGG + Intronic
1113766905 13:112887606-112887628 CTGCCAGGGCTGGGAGTGGCAGG - Intergenic
1115645823 14:35367956-35367978 CATGCAGGGCTGGGAGGAGGCGG - Intergenic
1115713631 14:36077413-36077435 CCTGGAGGGTGGAGAGTGGGAGG - Intergenic
1115940558 14:38603750-38603772 ATTGGAGGGTAGAGAGTGGGAGG - Intergenic
1116176211 14:41473505-41473527 CTGTCAGGGATGAGAGTGGAGGG + Intergenic
1117697038 14:58376107-58376129 CAAGCAGGGTTGAGAGTGGTAGG - Intergenic
1117965107 14:61198972-61198994 CTTGCAAGGCTGAGGGATGGGGG + Intronic
1118265817 14:64294241-64294263 CTTGCAGGGCGAAGAGCAGGCGG - Exonic
1118318372 14:64738982-64739004 CATGCAGGGCTGAGAGTCCTGGG - Intronic
1119383981 14:74245811-74245833 GTTGCTGGGCTGTGTGTGGGAGG - Intronic
1120569900 14:86104927-86104949 GTTCCAGAGCTCAGAGTGGGTGG + Intergenic
1121363629 14:93286600-93286622 TTTCCAGGGATGAGGGTGGGAGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122267433 14:100553263-100553285 CTCTCAGGGCTGAGAGGCGGCGG - Intronic
1122306912 14:100772259-100772281 CCTCCAGGGCGCAGAGTGGGTGG + Intergenic
1122829006 14:104386649-104386671 CCTGCTGGGCTGCGAGGGGGCGG - Intergenic
1122910875 14:104827029-104827051 CCTGCAGGACTGAGAGTCCGAGG - Intergenic
1123002150 14:105301304-105301326 GATGCGGGGCTGAGGGTGGGGGG + Exonic
1124591459 15:31057381-31057403 TTTGGAGGGAGGAGAGTGGGAGG + Intronic
1124602805 15:31149031-31149053 CTCGCAGGTCTGAGAGTGGCTGG + Intronic
1124789978 15:32718178-32718200 CCGGCAGGGATGTGAGTGGGCGG + Intronic
1125006762 15:34825249-34825271 CTTGCAGGGCTTACAGTTGAAGG + Intergenic
1126500560 15:49340043-49340065 CTTGCTGGGCTCAGTGGGGGTGG + Intronic
1126646650 15:50881592-50881614 CTCGGGAGGCTGAGAGTGGGAGG + Intergenic
1126792608 15:52234787-52234809 AGTTCAGGGCGGAGAGTGGGAGG - Intronic
1127287703 15:57545541-57545563 CCTGCAGGGATGGGAGTGAGAGG + Intronic
1128423755 15:67519744-67519766 CTTGGGAGGCTGAGGGTGGGAGG + Intergenic
1128914950 15:71551459-71551481 CTTGAAGGGCTGTGTGTTGGGGG + Intronic
1129325821 15:74799834-74799856 CATGCAGGTCTGTGAGTGGCTGG - Intronic
1129875540 15:78973216-78973238 CTTGGGGGGCAGAGTGTGGGTGG + Intronic
1129942326 15:79509296-79509318 CTAGCAGAGCTGAGAGTGAGAGG - Intergenic
1132500301 16:281944-281966 CTTGGAGGGCTGGGTCTGGGGGG + Intronic
1132517363 16:372020-372042 CTTGCAGATCTGATAGTGGCAGG + Exonic
1132600772 16:771810-771832 CCTGCAGGGTTCAGAGGGGGCGG + Intronic
1132660792 16:1060658-1060680 GCTGCATGGCTGAGGGTGGGTGG + Intergenic
1132726942 16:1343006-1343028 CTGGCCGTGCTGTGAGTGGGTGG + Exonic
1133033200 16:3021309-3021331 CTGCCTGGGCTGTGAGTGGGGGG + Exonic
1133039463 16:3052671-3052693 AATGCAGGTGTGAGAGTGGGAGG + Intronic
1133043306 16:3072304-3072326 AATGCAGGTGTGAGAGTGGGAGG + Intronic
1133344878 16:5063178-5063200 CACGCAGGGCTGAGAGGGCGAGG + Intronic
1133481765 16:6177611-6177633 CTTGCTGGGATGACAGTGAGGGG - Intronic
1133856333 16:9552610-9552632 ATTAGAGGGCAGAGAGTGGGAGG - Intergenic
1134640733 16:15827516-15827538 CTGGTGGGGCTGGGAGTGGGGGG + Intronic
1134773752 16:16833896-16833918 TTTGGAGGGCGGAGGGTGGGAGG - Intergenic
1135011247 16:18881004-18881026 CTTGTAGGGCTGAGTGAGGTGGG + Intronic
1135135278 16:19882698-19882720 CTTGGAGGGTTTTGAGTGGGAGG - Intronic
1135318148 16:21468610-21468632 CTTGTAGGGCTGAGTGAGGTGGG + Intergenic
1135371041 16:21900405-21900427 CTTGTAGGGCTGAGTGAGGTGGG + Intergenic
1135440745 16:22470310-22470332 CTTGTAGGGCTGAGTGAGGTGGG - Intergenic
1135475744 16:22772945-22772967 CCTGCAGGGAAGAGAGTGTGTGG + Intergenic
1135650041 16:24197959-24197981 CTTGCAGGGCATAGAGCAGGAGG + Intronic
1135958695 16:26977994-26978016 CCTGTAGGCCTGAGACTGGGAGG - Intergenic
1136112073 16:28069960-28069982 CTTGGAGGGCTGACGGTTGGGGG + Intergenic
1136775056 16:32867470-32867492 CTTTCAGGGATAAGAGTGGCTGG + Intergenic
1136895562 16:33994042-33994064 CTTTCAGGGATAAGAGTGGCTGG - Intergenic
1137033946 16:35552882-35552904 ATTGGAAGGCGGAGAGTGGGGGG - Intergenic
1137236926 16:46624607-46624629 CTTGCAGGGCAGACAGTGCCTGG - Intergenic
1137355318 16:47756880-47756902 CTTGGAGGGATGGGAGTGAGTGG + Intergenic
1137587362 16:49671538-49671560 CCTGCATGGCCAAGAGTGGGAGG + Intronic
1138706467 16:58920568-58920590 CTTGCTGGGCTGTGTGGGGGTGG + Intergenic
1139355838 16:66366689-66366711 CGTCCAGGGCTGAGCGTGAGTGG - Exonic
1139889770 16:70242480-70242502 CTTGTAGGGCTGAGTGAGGTGGG + Intergenic
1140490779 16:75334152-75334174 CTTGGATGTGTGAGAGTGGGTGG - Intronic
1141412557 16:83845401-83845423 CTCCCAGGCCTGAGAGTGGCGGG - Intergenic
1141623220 16:85248070-85248092 CCTGTGGGGCTGAGAGTGGGTGG + Intergenic
1141829462 16:86501696-86501718 CTGGCAGGGGTGGGGGTGGGGGG - Intergenic
1142257260 16:89020018-89020040 TCTGCAGGGCTGCCAGTGGGAGG - Intergenic
1203077474 16_KI270728v1_random:1129579-1129601 CTTTCAGGGATAAGAGTGGCTGG + Intergenic
1143139252 17:4731753-4731775 CTGCCAGGGCGGAGAGAGGGCGG - Intronic
1143512863 17:7405559-7405581 CATCCAGGGCTCCGAGTGGGGGG - Intronic
1143711538 17:8739320-8739342 CTGGCGGGGCTGTGAGTGGGTGG + Intronic
1143938257 17:10510023-10510045 ATTGGAGGGTGGAGAGTGGGAGG + Intronic
1144304656 17:13957206-13957228 GTTGGAGGGCTTAGGGTGGGAGG - Intergenic
1144477037 17:15597287-15597309 CTAGTGGGGATGAGAGTGGGTGG + Intronic
1144710638 17:17399424-17399446 CTGGAAGGGCTGAGAGTAGTGGG - Intergenic
1144946165 17:18970556-18970578 TTAGCAGAGCTGAGAGTGGCTGG - Exonic
1145885880 17:28382140-28382162 CTTGCAGGGGTGGGCGTTGGGGG + Intronic
1146025315 17:29315430-29315452 CTGGGAGGGTTGGGAGTGGGAGG + Intergenic
1146817398 17:35953868-35953890 CTGACAGTGCTGAGACTGGGAGG - Intergenic
1147482142 17:40776226-40776248 ATTTCAAGGCTGGGAGTGGGAGG - Intergenic
1147587083 17:41658901-41658923 CTTGCAGGGCAGGGAGGGGCTGG + Intergenic
1147724881 17:42560892-42560914 CTTGAAAGGCTGAGTGTGGAGGG - Intergenic
1148124318 17:45229093-45229115 CTTGGAGGGCTGGGGGAGGGCGG + Intronic
1148559412 17:48597383-48597405 CTACCAGGGCTGGGAGAGGGGGG + Intronic
1148603171 17:48908991-48909013 CTTGCGGGTCTGAGGGTGGGGGG - Intronic
1148773475 17:50079935-50079957 CTAGCTGGGTGGAGAGTGGGAGG + Intronic
1149222869 17:54436062-54436084 CTTGCTGGGCTGCGTGGGGGTGG - Intergenic
1149265932 17:54927675-54927697 CTTGCAGGGCTGTGGATGTGGGG - Intronic
1150571038 17:66387545-66387567 CCTACAGGGCTGAGAGGGGAGGG + Intronic
1151142467 17:72007045-72007067 TTTGGAGGGTGGAGAGTGGGAGG + Intergenic
1151322959 17:73362497-73362519 CTTGGAAGGCTGAAAGTGGCAGG - Intronic
1152225540 17:79091031-79091053 CTTCCAGGGCTGAGTGTGGGTGG + Intronic
1152480075 17:80545122-80545144 CCCGCAGGGCTGAGAGTGGCTGG + Intronic
1153120677 18:1722828-1722850 CTTGGAGGGTTGGGGGTGGGGGG - Intergenic
1153496324 18:5703581-5703603 CTGGCAGGTCTCAGAGTGGATGG - Intergenic
1153504310 18:5780134-5780156 CTTCCAGAGCTCAGAGTGGAAGG - Intergenic
1153589364 18:6657146-6657168 ATTGGAGGGTAGAGAGTGGGAGG + Intergenic
1155176369 18:23304818-23304840 TTAGCTGGGCTGAGAGTTGGGGG - Intronic
1155563083 18:27101483-27101505 CTGGCGGGGGTGAGGGTGGGCGG + Intronic
1155665194 18:28299450-28299472 CTTGCTGGGCTCCGTGTGGGTGG + Intergenic
1156979299 18:43265741-43265763 CTTGCTGGGCTCTGAGGGGGTGG + Intergenic
1157328516 18:46686338-46686360 CTTGCAGAGGTGAGAGTAGCAGG - Intronic
1157450342 18:47781833-47781855 CTTGCAGGGGTGGGGCTGGGGGG - Intergenic
1157531029 18:48420868-48420890 GTTGAAGGGCTGTGTGTGGGTGG - Intergenic
1157600491 18:48890213-48890235 CTGGCAGGGCAGAGAGGGGGAGG - Intergenic
1157804080 18:50645055-50645077 CCTGCAGGCCAGGGAGTGGGTGG + Intronic
1158516376 18:58133941-58133963 ATTGTAGGGATGAGAGTGTGAGG + Intronic
1158797380 18:60863542-60863564 GTTGCAGGGCTGAGAGGTAGGGG - Intergenic
1159908236 18:74118103-74118125 CTTGAGAGGCTGAGGGTGGGAGG - Intronic
1160069839 18:75618243-75618265 TTTTCAGGGTTGAGAGTTGGTGG + Intergenic
1160146782 18:76371754-76371776 CTTGCAGTCCTGAGAGTGCCTGG - Intronic
1160540265 18:79617243-79617265 CTTGGGGGGCTCTGAGTGGGGGG - Intergenic
1160675441 19:388830-388852 CGTGCAGGGCTGAGGGTGTGGGG - Intergenic
1160974196 19:1784706-1784728 CTTGGAGGGCCGAGAGGGGCCGG + Intronic
1161327208 19:3669693-3669715 CTGGCAGGGCTGATAGGGTGGGG - Intronic
1161358821 19:3834703-3834725 CTTGCATGGGTGAGAGCGGTGGG - Intronic
1161894339 19:7069302-7069324 GAGGCAGGGCTGAGTGTGGGTGG - Intergenic
1162589030 19:11578749-11578771 GCTGCAGGGCTGGGAATGGGGGG - Exonic
1162742896 19:12783338-12783360 TTTGCAGGGGTGGGGGTGGGGGG - Intronic
1163446735 19:17351503-17351525 CAGGCAGGGCTGGGAGTTGGGGG + Exonic
1163458153 19:17420672-17420694 CTTGCAGGGAGGAGCGGGGGAGG + Intronic
1163554292 19:17983579-17983601 CTTGCAGGGCTCTGGGGGGGTGG + Intronic
1163711729 19:18851121-18851143 CTTGCCGGGGTGAGGATGGGTGG + Intronic
1163819403 19:19487482-19487504 CTTGCTGGGCCGAGGGTGGGTGG + Intronic
1164628442 19:29745231-29745253 CGAGGTGGGCTGAGAGTGGGAGG + Intergenic
1165149173 19:33750900-33750922 GTTGCAGGGCTGGGTGGGGGTGG - Intronic
1165330844 19:35140491-35140513 CTTGCTGGGCTTAGAGTCTGAGG - Intronic
1165746251 19:38231449-38231471 CATGAAGTGCAGAGAGTGGGTGG - Intergenic
1165797660 19:38528240-38528262 CATCCAGGGCTGGGAGTGAGAGG + Intronic
1166088708 19:40494069-40494091 CCTGCAGGGCAGAGAGTTGGGGG - Intronic
1166334607 19:42097945-42097967 CTGAGAGGGGTGAGAGTGGGTGG - Intronic
1166564430 19:43754966-43754988 CTCGCCGGGCTGAGCGTGCGTGG + Exonic
1167595018 19:50422936-50422958 CCTGCAGGGCTGTAGGTGGGGGG - Exonic
1167608536 19:50494692-50494714 CTGGCAGGGCAGAGAGGAGGGGG + Intergenic
1168254730 19:55159164-55159186 CTGGCAGGGCTCACAGTGTGGGG + Exonic
925265949 2:2566546-2566568 CGTGTGGGGCTGAGAGTGAGGGG + Intergenic
925691487 2:6528610-6528632 CTTGAAGGGTGGAGGGTGGGAGG + Intergenic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
927014270 2:18940838-18940860 CTTTCAGGGATGAGGGAGGGAGG + Intergenic
927519196 2:23689020-23689042 CCTGCAGAGCTGTGAGGGGGTGG - Intronic
928018423 2:27681014-27681036 CTTGCAGGGGTTAGGGTAGGAGG - Intronic
929154597 2:38778118-38778140 CTTGGAGGTCTGAGAGTCGCGGG - Intronic
929603554 2:43219822-43219844 CTGGCACGGCTGAGGGAGGGAGG - Intergenic
929610907 2:43270033-43270055 CTGGCAGGGGTGAGATGGGGTGG - Intronic
930872634 2:56184222-56184244 TGTGCAGGGCAGAGAGTGCGGGG + Exonic
931004082 2:57828169-57828191 CTTGCTGGGCTCCGTGTGGGTGG - Intergenic
932460677 2:71879972-71879994 CTGGCAGGGGTGGCAGTGGGTGG + Intergenic
933577009 2:84080507-84080529 CTTGTAGGGCAGATAGTTGGTGG + Intergenic
934081211 2:88469147-88469169 CTGTCAGGGCTGAGAGCGGGGGG + Intergenic
934860980 2:97763427-97763449 CATCAAGGGGTGAGAGTGGGCGG - Intronic
935291813 2:101617518-101617540 AGTGCAGGGCAGAGAGTGAGTGG + Intergenic
936345861 2:111674404-111674426 TTTGGAAGGCTGAGGGTGGGTGG + Intergenic
936933897 2:117819184-117819206 CTATCAGGGATGAGGGTGGGAGG - Intronic
937413965 2:121699684-121699706 CTTGCAAGGCTGAGGGAGGTGGG - Intergenic
938127098 2:128682454-128682476 CTTGCTGTGCAGAGAGGGGGTGG + Intergenic
938570071 2:132554696-132554718 CTGGCAGGGCTTAAAGGGGGAGG + Intronic
938847755 2:135228650-135228672 CTTGATGGGTTGAGTGTGGGAGG + Intronic
939779215 2:146423777-146423799 GTTGGAGGGCTGTGGGTGGGAGG + Intergenic
940728588 2:157362936-157362958 TCTGCATGACTGAGAGTGGGGGG - Intergenic
940867237 2:158829588-158829610 ATTGCTGGTCTGTGAGTGGGAGG + Intronic
940932276 2:159447174-159447196 CTTCCAGGGCTGAGAGAGAGGGG + Intronic
942042630 2:172081114-172081136 CTTGGAGGGCTGGATGTGGGCGG - Exonic
942876906 2:180811340-180811362 CTTTTAAGGCTGAGAGAGGGAGG + Intergenic
944100365 2:196019900-196019922 CTTGCTGTGCGGGGAGTGGGTGG - Intronic
944605109 2:201345745-201345767 ATTGGAGGACAGAGAGTGGGTGG + Intronic
946310677 2:218880962-218880984 CCTGACGGGCTGGGAGTGGGGGG - Exonic
946317620 2:218928148-218928170 GTTGGAGGGCAGAGAGTGGGGGG + Intergenic
946464829 2:219902729-219902751 CCTGCAGGCCTGAGGGTGTGAGG + Intergenic
946733762 2:222733983-222734005 CTTTCATTGCTGAGAGGGGGTGG + Intergenic
947033485 2:225824757-225824779 CTTGCTGGGCTCCGTGTGGGTGG - Intergenic
947387225 2:229603615-229603637 TTTGCAGAGCTGAGAGAGGTGGG + Intronic
947454293 2:230239256-230239278 CATTCAGGACTGAGAGTGGTGGG - Intronic
947839294 2:233197475-233197497 CTGGCAGGGCAGAGAGATGGTGG - Intronic
947875190 2:233463053-233463075 TTTGCAGGGCTGAGCATGGAAGG - Intronic
948045486 2:234940556-234940578 CTGGGAGGGCAGAGAGTGGAGGG - Intergenic
948671932 2:239574440-239574462 CCTGCAGGGCTGAGAGCAGAAGG + Intergenic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
948948588 2:241234616-241234638 CTGGCAGGGCTGACATTTGGAGG - Intronic
1168741820 20:198616-198638 CTTGGAGGGTGGAGGGTGGGGGG + Intergenic
1169153698 20:3311246-3311268 CTTGGAAGGCTGAGACTGGAGGG - Intronic
1169736138 20:8839570-8839592 CTTGTAGGGATGTGTGTGGGTGG - Intronic
1170598568 20:17823566-17823588 CTGGCAGGGCGGAGAGTTTGAGG - Intergenic
1170991169 20:21303190-21303212 CTTGCCGGGCTGTTTGTGGGAGG - Intergenic
1171372897 20:24673179-24673201 CTTGCAGGGCTCAGAGGAGGGGG - Intergenic
1172587379 20:36093889-36093911 CGTGCAGGGCTCTGGGTGGGTGG + Intronic
1172836949 20:37879207-37879229 GAGGCAGGGCTGAGGGTGGGCGG - Intergenic
1173006224 20:39141678-39141700 GTGGCAGGGTTGAGGGTGGGTGG + Intergenic
1173598262 20:44274203-44274225 CTTACAGGGATGAGAGTGGATGG - Intronic
1173659010 20:44720123-44720145 TTTGCAGGACTGAGTGGGGGCGG + Intronic
1173989365 20:47288732-47288754 ATAGCAGGGCTGAGAGTGCAAGG - Intronic
1174449169 20:50609270-50609292 GTAACAGGGCTGAGAGGGGGTGG - Intronic
1174568191 20:51482112-51482134 CTTGGGGGGCTGGGGGTGGGGGG - Intronic
1175803937 20:61816907-61816929 CTTGCAGAAATGAGAATGGGTGG - Intronic
1175833739 20:61980820-61980842 CTTGCAGGGGAGAGACTGGGGGG - Intronic
1175851604 20:62096981-62097003 CCAGCAGGGCTGAGAGGGGGAGG + Intergenic
1176059859 20:63167818-63167840 CTAGCAGGGCTGAAAGAAGGAGG + Intergenic
1176241986 20:64079566-64079588 CTCACCGGGCTGAGAGGGGGAGG + Intronic
1176286476 21:5021688-5021710 CTTGCAGGGATCAGGGAGGGAGG + Intergenic
1177747345 21:25234253-25234275 ATTGGAGGGTGGAGAGTGGGAGG + Intergenic
1178580044 21:33830883-33830905 CTTGCAGAGAAGAGGGTGGGGGG + Intronic
1179870705 21:44241787-44241809 CTTGCAGGGATCAGGGAGGGAGG - Intergenic
1179884818 21:44309368-44309390 CCTGCAGGGGTGAGAGGAGGGGG + Intronic
1180079803 21:45481459-45481481 CGTGCAGGGCAGGGAGTGTGGGG + Intronic
1180599623 22:17007675-17007697 CCTGCAGGTCGGAGAGTGGGCGG - Intronic
1180673224 22:17569596-17569618 CTTCCAGGTCTCTGAGTGGGCGG + Intronic
1181136798 22:20772980-20773002 CTTGCAGGGCTGAGGTGAGGAGG + Intronic
1181660198 22:24341163-24341185 TTTGCAGGGCAGATACTGGGAGG + Intronic
1182204480 22:28609801-28609823 CTTGCTGGGCTCCGTGTGGGTGG - Intronic
1183092175 22:35529958-35529980 CTTGCAGGGCATGGGGTGGGAGG - Intergenic
1183392517 22:37553642-37553664 CTTGGTGGGGTGAGAGGGGGCGG - Intergenic
1183433491 22:37780137-37780159 GTTGCAGAGCTGAGAGCAGGGGG - Intergenic
1183686625 22:39364703-39364725 CACAGAGGGCTGAGAGTGGGTGG - Intronic
1184098224 22:42328149-42328171 CCTGCATGGCTGAGCCTGGGAGG - Intronic
1184172738 22:42769283-42769305 CTTGAGGGGCAGAGGGTGGGGGG + Intergenic
1184224077 22:43119056-43119078 CCTGCAGGGCTCCGAGTGGGAGG - Intronic
1184602612 22:45552439-45552461 TTAGCAGTGCTGAGAGGGGGTGG - Intronic
1184876934 22:47282239-47282261 GGTGCAGGGCTGAGACTGGCGGG + Intergenic
1185415944 22:50710329-50710351 GTTGCAGAGCTGGGAGTGAGAGG + Intergenic
949509994 3:4759226-4759248 CTTGCAGGGCTGGGGGAGGATGG + Intronic
950094801 3:10322521-10322543 GTTGCAGGGGTGTGAGGGGGTGG + Intergenic
950622497 3:14216972-14216994 ATCGCAGGGCTGAGAGGTGGAGG - Intergenic
952123531 3:30273390-30273412 CTGGGAGGGTTGAGGGTGGGGGG - Intergenic
952769079 3:36981135-36981157 CTTGAGGGCCTGAAAGTGGGAGG - Intergenic
953420762 3:42751581-42751603 ATGGCTGGGCTGACAGTGGGAGG + Intronic
953916256 3:46922889-46922911 CTTGCTAGGCTGAGAGAGAGTGG - Intronic
954482309 3:50811944-50811966 CCTGTAGGGCTGAGAGAGGGTGG + Intronic
954695338 3:52421565-52421587 TTTGTAGGGGTGAGGGTGGGAGG + Intronic
954773430 3:52995496-52995518 CTTGGTAGGCTGAGAATGGGAGG - Intronic
955033119 3:55240206-55240228 ATTGGAGGGTGGAGAGTGGGAGG + Intergenic
955451784 3:59076336-59076358 CTTGAGAGGCTGACAGTGGGAGG - Intergenic
955488494 3:59459116-59459138 TTTGGAGGGTGGAGAGTGGGAGG - Intergenic
956558091 3:70543396-70543418 CTTGACGGGCTGAGAGTGGCAGG - Intergenic
956744771 3:72302486-72302508 CTTACAGGGCTTGGAGTGGAAGG + Intergenic
957580570 3:82067316-82067338 GTAGAAGGGCTGAGGGTGGGAGG + Intergenic
958547062 3:95567416-95567438 CTTCCTGGGATTAGAGTGGGAGG + Intergenic
960029586 3:113043858-113043880 TTTTCAGGGAGGAGAGTGGGAGG - Intergenic
960384032 3:116998478-116998500 TTTTCTGGGGTGAGAGTGGGAGG - Intronic
961406290 3:126682130-126682152 CCTGCAGGGCTGGGAGCTGGGGG + Intergenic
961750045 3:129089304-129089326 CTTGCAGGGCAGACAGTGCCTGG - Exonic
962599041 3:136976570-136976592 CTGCCGGGGCTGAGACTGGGAGG - Intronic
962809022 3:138946231-138946253 CTTGCCGGGCTGGAAGTGCGCGG + Exonic
963159221 3:142133446-142133468 TTTGCAGGGCTGAGGGAGGCAGG - Intronic
963632099 3:147746246-147746268 ATTGAAGGGTGGAGAGTGGGAGG - Intergenic
964672156 3:159238574-159238596 CTTGAAGAGCTGAGTGGGGGAGG + Intronic
964707914 3:159640371-159640393 AATGCAGGTCTGAGTGTGGGCGG + Intronic
965162795 3:165156377-165156399 CTCGGGTGGCTGAGAGTGGGAGG - Intergenic
965816692 3:172643784-172643806 CTTGCAGGCCTGAGAAAAGGAGG - Intronic
966125194 3:176568266-176568288 GTTGCAGGGCAGCGAGTGGGTGG - Intergenic
966932648 3:184685804-184685826 CTCTCACGGCTGAGTGTGGGGGG + Intergenic
967052398 3:185796987-185797009 CTGGGAGGCCTGAGAGTGGATGG - Intronic
967134718 3:186503705-186503727 CTCCCAGGGCTGAGTATGGGTGG - Intergenic
967184792 3:186935152-186935174 CTTGAAGGGTGGAGGGTGGGAGG - Intronic
967377968 3:188826776-188826798 GGTGCAGAGATGAGAGTGGGGGG - Intronic
967937158 3:194738393-194738415 CATGCCGGGATGTGAGTGGGAGG - Intergenic
970280417 4:14449016-14449038 CCTTCTGGTCTGAGAGTGGGAGG - Intergenic
971307996 4:25500583-25500605 CTTGGAGGACTGTGGGTGGGTGG + Intergenic
971703198 4:30007255-30007277 GTTGCAGGGAGGAGAGTGGGAGG + Intergenic
972341816 4:38158572-38158594 ATTGCAGGACTGAAAGTAGGTGG - Intergenic
972370072 4:38414975-38414997 CTTCCTGGGCTGACAGTGGGTGG - Intergenic
976178755 4:82379879-82379901 CTTGGGAGGCTGAGGGTGGGAGG - Intergenic
977651563 4:99475824-99475846 ATTGCAGGGTGGAGAGTGGGAGG - Intergenic
978338596 4:107697126-107697148 CTTAGCGGGCTGAGAGTGGCTGG - Intronic
978430958 4:108633059-108633081 ATTGCAGGGTAGAGGGTGGGAGG - Intergenic
978968106 4:114767815-114767837 ATTGCAGGGCAGAGGGTGGGAGG + Intergenic
982265512 4:153535038-153535060 CTGGCAGTGCTGAGCCTGGGTGG + Intronic
982404966 4:155009237-155009259 CTAACAAGGCTGAGGGTGGGTGG + Intergenic
982459566 4:155651922-155651944 TTTGAAGGTCTGAGAGTGAGGGG + Intergenic
985589130 5:755736-755758 CAGGCAGGGCTGAGACTGGAGGG - Intronic
985603809 5:848252-848274 CAGGCAGGGCTGAGACTGGAGGG - Intronic
985852655 5:2399962-2399984 CTTGCAGGCCTGCTTGTGGGTGG - Intergenic
985875746 5:2592430-2592452 CTTGCAGGGCTGAGACAGCCTGG - Intergenic
985906654 5:2842977-2842999 CTTGCACGGCTGATAGGCGGTGG + Intergenic
985961188 5:3304603-3304625 GTGGCAGGGCTGGGAGTGGGGGG - Intergenic
986014814 5:3748568-3748590 GTTGCAGGGGAGAGAGAGGGAGG - Intergenic
986227363 5:5828326-5828348 CCAGCAGGGCTGAGAGTGGTAGG + Intergenic
987308530 5:16660858-16660880 CTGGCGGGGCGGGGAGTGGGGGG + Intergenic
988588458 5:32528250-32528272 CTTGGAGGGCTGAGGCAGGGAGG - Intergenic
988619383 5:32807211-32807233 ATTGGAGGGCGGAGGGTGGGAGG - Intergenic
989440261 5:41462993-41463015 GATGCAGGACTGACAGTGGGAGG + Intronic
991247623 5:64524899-64524921 CTTGCAGTCCCCAGAGTGGGTGG + Intronic
991404117 5:66285179-66285201 CTGGCAGGTCTCAGAGTTGGTGG - Intergenic
992056741 5:72997758-72997780 CTTCCAGGGCAGAGAGGGGTTGG - Intronic
992597567 5:78361087-78361109 CTGGCAGGGCCGGGAGTCGGCGG + Intronic
993325985 5:86537173-86537195 TTTGGAGGGTGGAGAGTGGGAGG + Intergenic
993629177 5:90263486-90263508 CTTGCACGGCGGAGACTGGCAGG - Intergenic
995449384 5:112283757-112283779 CCTGCTGGGCTGTGAGTGCGAGG - Intronic
996109054 5:119543259-119543281 GTTGCAGGGGTGAAGGTGGGAGG - Intronic
997267084 5:132501247-132501269 CTTGCTGGGCAGACAGCGGGGGG - Intergenic
997347377 5:133201876-133201898 CTTGCAGGGCTGAGCTGGAGCGG + Intronic
998008365 5:138672719-138672741 CTTGGAAGGCTGAGCCTGGGAGG + Intronic
998619622 5:143779904-143779926 ATTGGAGGGTGGAGAGTGGGAGG + Intergenic
999049849 5:148510560-148510582 CTTTCAGGGATGAGAGTGGAGGG - Intronic
999308304 5:150535035-150535057 CTTGCAGGGCAGAGCGGGGCGGG + Intronic
999318100 5:150596991-150597013 CTTGCAGGGCTGTGATAGTGAGG + Intergenic
999400273 5:151258893-151258915 CTGGGAGAGGTGAGAGTGGGTGG + Intronic
999409634 5:151339646-151339668 CTTGCTGAGCTGAGAGTGTGAGG - Intronic
1000279120 5:159767012-159767034 ATTGCAGGGGCAAGAGTGGGAGG - Intergenic
1000477770 5:161732601-161732623 TTTGCAGGGCGGAGTGGGGGAGG + Intergenic
1000642193 5:163716119-163716141 CTTGAATGGCGGAGAGAGGGAGG + Intergenic
1001653216 5:173329633-173329655 CTCGCAGGGCTGGGGGAGGGCGG + Intergenic
1002316974 5:178349771-178349793 CTTGCAGGGGTGAGAGTGGGGGG + Intronic
1002487489 5:179549683-179549705 CTTGGGGGGCTGAGAGTGGGAGG - Intergenic
1002494627 5:179603413-179603435 CAGGCAGGGCGGAGGGTGGGAGG - Intronic
1002633979 5:180598171-180598193 CAGGCAGGGGTGAGAGTTGGGGG + Intergenic
1003476709 6:6490365-6490387 ATTGGAGGGTGGAGAGTGGGAGG + Intergenic
1004312224 6:14555640-14555662 CTTGGAGGGCTGAGGGCAGGAGG - Intergenic
1005349418 6:24919528-24919550 CTGGCAGGAGTGAGAGTTGGGGG + Intronic
1005853284 6:29839140-29839162 CTGGAAGGGATGTGAGTGGGTGG - Intergenic
1006081153 6:31567625-31567647 GTTGCAGGGGAGAGAGGGGGAGG - Intergenic
1006639806 6:35484158-35484180 GTGGCGGGGCTGAGAGAGGGTGG - Intronic
1006847347 6:37071791-37071813 CTTGCAGAGCTGTGAATAGGAGG + Intergenic
1006876842 6:37305131-37305153 CTCCCAGGACTGAGCGTGGGGGG - Intronic
1007293275 6:40802680-40802702 CTCCAAGGGCAGAGAGTGGGTGG + Intergenic
1007637393 6:43307683-43307705 CAGCCAGGGCTGGGAGTGGGGGG + Exonic
1010213655 6:73382942-73382964 CTTGGAAGGCTGAGCCTGGGAGG - Intronic
1010659027 6:78547317-78547339 ATTGGAGGGTAGAGAGTGGGAGG - Intergenic
1011260935 6:85468927-85468949 TTTGCAGGGCCCAGTGTGGGGGG + Intronic
1011933736 6:92747811-92747833 CTTGCAGGGGTGGGAGGGTGTGG - Intergenic
1013055418 6:106578114-106578136 CTTGCAGGACTGAGAGGAGGTGG - Intronic
1014766006 6:125407607-125407629 CATGCGGGGCTAAGAGTGTGGGG - Intergenic
1015712800 6:136160562-136160584 CAGGCAAGGCTGAGAGTAGGTGG - Intronic
1015889082 6:137951424-137951446 GTTGCAGGGCTGTGAGAAGGTGG - Intergenic
1016714241 6:147204660-147204682 CTTGCAGAGCTGAAAGTGCTCGG - Exonic
1017634876 6:156434029-156434051 ATTGGAGGGTGGAGAGTGGGAGG - Intergenic
1018709100 6:166485115-166485137 CTTCCAGGGCTGTGTGGGGGAGG + Intronic
1019353648 7:567863-567885 CTAGAAGGGCTGGGAGAGGGGGG + Intronic
1019504021 7:1381694-1381716 CTTGGGGGGCTGGGAGGGGGTGG - Intergenic
1019516812 7:1443807-1443829 CCTGCAGAGCTGTGAGGGGGTGG + Intronic
1019711999 7:2522062-2522084 CGTGCAGGGCTGGGAGAGGGGGG - Intronic
1020130683 7:5556912-5556934 CCTGCAGGGAGGAGGGTGGGTGG + Intronic
1021197391 7:17688514-17688536 ATTGCAGGGGTGGGAGTGGCAGG - Intergenic
1021534673 7:21689810-21689832 CTTGCATTGCTGAGAGGGGAGGG - Intronic
1021616602 7:22508272-22508294 CTTGCAGGGCTGAGAGTGGGAGG - Intronic
1022926407 7:35059485-35059507 CTTGCAGGGCTGAGAGTGGGAGG - Intergenic
1022953066 7:35356596-35356618 ATGGCAGGGGTGAGGGTGGGTGG + Intergenic
1023818986 7:43969906-43969928 CTGGTAGGGCTGAGGGTGGAGGG - Intergenic
1025110847 7:56214943-56214965 CTTGGGAGGCTGAGAGTGGAAGG + Intergenic
1026266105 7:68797332-68797354 CTTGAAGGGCTGCCAGTGGCTGG - Intergenic
1026459139 7:70598118-70598140 CTGGAAGGGCTGAGACTGGGAGG - Intronic
1026976060 7:74499175-74499197 GTGGCAAGGCTGGGAGTGGGAGG - Intronic
1027051694 7:75025089-75025111 CTTGCAGGGCTGGGGCTGGCGGG + Intergenic
1027924188 7:84439256-84439278 CTTCCTGGGCTTAAAGTGGGAGG - Intronic
1028239900 7:88406952-88406974 GCAGCAGGGCTGAGAGAGGGAGG - Intergenic
1028375857 7:90146066-90146088 CTTGCAGGGCTGAGAGTGGGAGG + Intergenic
1028419129 7:90612429-90612451 CTTACAGGGCTGGGCCTGGGTGG + Intronic
1028968371 7:96827951-96827973 AGGGCAGAGCTGAGAGTGGGAGG + Intergenic
1029535911 7:101157555-101157577 CTTCCAGGGCAGAGACTGGAGGG - Intronic
1029824410 7:103174170-103174192 CTTGCAGGGCTGAGAGTGGGAGG - Intergenic
1030500832 7:110356709-110356731 CTTGCTGGGCTCGGTGTGGGTGG + Intergenic
1030560997 7:111085962-111085984 CCTGGAGGGTTAAGAGTGGGAGG + Intronic
1031896001 7:127348121-127348143 CTTGCGGGGCTGAGAGGCGTCGG - Intronic
1031991897 7:128203768-128203790 TTTGGAGGGGTGAGAGTTGGGGG + Intergenic
1032480092 7:132239265-132239287 CTTGCAGCCCTGGGGGTGGGAGG + Intronic
1032750065 7:134830557-134830579 ATTGGAGGGTTGAGGGTGGGAGG - Intronic
1033050518 7:138000427-138000449 AGTGCAGGGCTGAGAGGGAGTGG - Intronic
1033525431 7:142209026-142209048 CTTGCAGGGCTCAGAGGATGTGG + Intronic
1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG + Intronic
1034330690 7:150279686-150279708 CCTGCAGAGCTGGGGGTGGGTGG - Intronic
1034349855 7:150408517-150408539 CTCTCAGGGCTGGGAGTGGTGGG + Intronic
1034667353 7:152830163-152830185 CCTGCAGAGCTGGGGGTGGGTGG + Intronic
1034882616 7:154774094-154774116 CATGCAGGGCTGAGAGGGGCAGG - Intronic
1035239685 7:157521488-157521510 GTCGCAGGGCAGTGAGTGGGAGG + Intergenic
1035721607 8:1797203-1797225 CTGGCAGGGGTGACTGTGGGGGG - Intergenic
1037580052 8:20239746-20239768 GTGGCAGAGCTGAGAGAGGGGGG + Intergenic
1037681550 8:21101865-21101887 CTGGCAGGGGAGGGAGTGGGAGG - Intergenic
1037893461 8:22636447-22636469 CTTGGGGGGCTGAGAGAGGAGGG + Intronic
1039143857 8:34423345-34423367 CTTCAAGGGCTGGGAGGGGGTGG - Intergenic
1039200905 8:35092554-35092576 CCTGGAGGGCAGAGAGTGGCAGG + Intergenic
1039441549 8:37598612-37598634 TTGGCAGAGCTGGGAGTGGGTGG + Intergenic
1041256674 8:55984739-55984761 ACTGGAGGGCTGAGAGTGAGGGG - Intronic
1042192079 8:66197362-66197384 CTGGGATGGTTGAGAGTGGGTGG - Intergenic
1042689586 8:71483262-71483284 CTTGAGGAGCTGAGAGAGGGAGG - Intronic
1042693938 8:71534748-71534770 GTTGCAGGGCTGGGGGTGAGGGG + Intronic
1047973441 8:130106883-130106905 CCTGGAGCCCTGAGAGTGGGAGG + Intronic
1048009666 8:130445397-130445419 CATGCAGTGGGGAGAGTGGGGGG - Intergenic
1049096465 8:140551215-140551237 CTTGCAGGGCTGACTCTGGTTGG - Intronic
1049277464 8:141726946-141726968 CTGGCAGGGCTGGGCGTGCGTGG + Intergenic
1049423371 8:142526520-142526542 CCTGCCGGGCAGAGAGTGGTGGG - Exonic
1049472380 8:142782269-142782291 CTTTCAGGGGTGGGAGTGGTAGG + Intergenic
1049856233 8:144863682-144863704 TTTACAGGGAGGAGAGTGGGAGG + Intergenic
1051777326 9:20650208-20650230 CCTGGAGGGCAGAAAGTGGGAGG + Intergenic
1051782807 9:20708665-20708687 CTTGGAAGGCTGAGGATGGGCGG + Intronic
1051877300 9:21806083-21806105 GTTGAAGGGTTAAGAGTGGGAGG + Intronic
1052437472 9:28446900-28446922 ACTGCAGGGCAGAGAGTGAGAGG - Intronic
1052964265 9:34327627-34327649 TTTGGAAGGCTGAGAGTGTGTGG + Intronic
1053020209 9:34689239-34689261 CTTGGAGAGCAAAGAGTGGGAGG + Intergenic
1055716301 9:79121803-79121825 CTGGCAGGACTGAGAGATGGTGG - Intergenic
1056565554 9:87769846-87769868 GCTGCAGGGCTGGGCGTGGGAGG - Intergenic
1058176071 9:101737863-101737885 CTGGCAGGGCTGCGGGTGCGAGG + Exonic
1058241840 9:102572318-102572340 ATTGGAGGGGTGAGAGTGAGGGG - Intergenic
1059305227 9:113348697-113348719 CTTTCTGGGGTGGGAGTGGGTGG + Intergenic
1060197781 9:121634570-121634592 CGCGCAGGTCTGAGAATGGGTGG + Intronic
1060258301 9:122052164-122052186 CTTTCAGGCCTGAAAGAGGGAGG + Intronic
1060807522 9:126586996-126587018 CTGGCAGGGCTCAGAGTGAGGGG + Intergenic
1061429823 9:130523912-130523934 CTTTCAGAGCTCAGAGTAGGGGG - Intergenic
1061527157 9:131175551-131175573 CCTGCGGGGCTGAGATGGGGTGG - Exonic
1061898036 9:133658622-133658644 CCTGCATGGCTGAGAGGGTGTGG + Exonic
1062050049 9:134442539-134442561 CTTCCTGGGGTGAGCGTGGGGGG + Intergenic
1062061945 9:134501664-134501686 CGTGCAGGGCTCGGAGCGGGGGG + Intergenic
1062581635 9:137231533-137231555 CCTGCAGGGCGTAGAGAGGGAGG + Intronic
1185713323 X:2321581-2321603 CTCGCAGGGCAGAGAGAGAGGGG - Intronic
1185824042 X:3232055-3232077 CTCGCATGGCAGAGGGTGGGAGG + Intergenic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1186135109 X:6511064-6511086 GTTGGAGGGTAGAGAGTGGGAGG + Intergenic
1186472554 X:9832732-9832754 GTTGCAGGGGTAAGGGTGGGGGG + Intronic
1188171969 X:26938592-26938614 TTTGGAGGGCTGGGGGTGGGAGG + Intergenic
1189327546 X:40122054-40122076 CTTGGAGGGCTGGAAGTGGCTGG - Intronic
1189359834 X:40341401-40341423 CCTGCAGAGCTGAGAGTTGCAGG + Intergenic
1189642878 X:43092934-43092956 CTTGGGGGGCTGAGGGTGGGAGG - Intergenic
1189679904 X:43505196-43505218 CTTGGGAGGCTGAGATTGGGGGG - Intergenic
1189895608 X:45652753-45652775 ATTGGAGGGTGGAGAGTGGGAGG - Intergenic
1190132522 X:47762815-47762837 TTTGGAGGGTGGAGAGTGGGAGG - Intergenic
1190336778 X:49267376-49267398 CTGGGAGGGCTGGGAGTTGGGGG + Intergenic
1190745456 X:53319776-53319798 CTTGAAGGGTGGAGAGGGGGTGG + Intronic
1192139984 X:68638906-68638928 CTGGCAGGGCTGAGAGAGCAGGG - Intergenic
1192445112 X:71205326-71205348 ATTAGAGGGCAGAGAGTGGGAGG - Intergenic
1192687602 X:73323406-73323428 ATGGCAGGACTGAGAGTGGATGG - Intergenic
1193144640 X:78064328-78064350 CTTGCAAGGGTGTGGGTGGGGGG - Intergenic
1195661503 X:107383672-107383694 GTTGCAGGGTGGAGAATGGGTGG + Intergenic
1196216812 X:113062396-113062418 ACTGGAGGGCAGAGAGTGGGAGG - Intergenic
1196826502 X:119744390-119744412 CTTGCAGGGCTGAGGTGGGGAGG + Intergenic
1197865056 X:131008741-131008763 CTTGTATGGGTGAGAGTGTGAGG - Intergenic
1199016310 X:142819914-142819936 CTTTCAGCGCTGTGAGGGGGGGG - Intergenic
1199417245 X:147599506-147599528 CTCACAGGGCAGAGAGAGGGAGG - Intergenic
1199594165 X:149493555-149493577 CTGGGAGGGATGAGAGTGGATGG + Intronic
1199702405 X:150392330-150392352 CTTGCAGGACTGAGTAGGGGTGG + Intronic
1200228533 X:154432564-154432586 CTGGAAGGGCTGTGAGGGGGTGG - Intronic
1200254727 X:154574130-154574152 TTTGCAGGGCGGAGGTTGGGAGG + Intergenic
1200263042 X:154630278-154630300 TTTGCAGGGCGGAGGTTGGGAGG - Intergenic
1200386787 X:155900197-155900219 CTTGTGGGGCAGAGATTGGGGGG - Intronic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic